LOCUS       XM_009861931            1488 bp    mRNA    linear   INV 22-OCT-2018
DEFINITION  PREDICTED: Ciona intestinalis homeobox protein unc-4 homolog
            (LOC778790), partial mRNA.
ACCESSION   XM_009861931
VERSION     XM_009861931.3
DBLINK      BioProject: PRJNA187185
KEYWORDS    RefSeq; corrected model.
SOURCE      Ciona intestinalis (vase tunicate)
  ORGANISM  Ciona intestinalis
            Eukaryota; Metazoa; Chordata; Tunicata; Ascidiacea; Phlebobranchia;
            Cionidae; Ciona.
REFERENCE   1
  AUTHORS   Imai,K.S., Hino,K., Yagi,K., Satoh,N. and Satou,Y.
  TITLE     Gene expression profiles of transcription factors and signaling
            molecules in the ascidian embryo: towards a comprehensive
            understanding of gene networks
  JOURNAL   Development 131 (16), 4047-4058 (2004)
   PUBMED   15269171
REFERENCE   2
  AUTHORS   Satou,Y. and Satoh,N.
  TITLE     Genomewide surveys of developmentally relevant genes in Ciona
            intestinalis
  JOURNAL   Dev. Genes Evol. 213 (5-6), 211-212 (2003)
   PUBMED   12736827
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_020176.2) and transcript sequence (AB210740.1) annotated using
            gene prediction method: Gnomon, supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Oct 22, 2018 this sequence version replaced XM_009861931.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Ciona intestinalis Annotation
                                           Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            assembly gap :: added 216 transcript bases to patch genome assembly
                            gap
            ##RefSeq-Attributes-END##
            COMPLETENESS: incomplete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1114              EAAA01000755.1     21338-22451
            1115-1272           EAAA01000755.1     25018-25175
            1273-1488           AB210740.1         600-815
FEATURES             Location/Qualifiers
     source          1..1488
                     /organism="Ciona intestinalis"
                     /mol_type="mRNA"
                     /db_xref="taxon:7719"
                     /chromosome="11"
     gene            1..>1488
                     /gene="LOC778790"
                     /note="The sequence of the model RefSeq transcript was
                     modified relative to its source genomic sequence to
                     represent the inferred CDS: added 216 bases not found in
                     genome assembly; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 1 mRNA, 1 EST, 2
                     Proteins, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 29 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:778790"
     CDS             805..>1488
                     /gene="LOC778790"
                     /note="The sequence of the model RefSeq protein was
                     modified relative to its source genomic sequence to
                     represent the inferred CDS: added 216 bases not found in
                     genome assembly"
                     /codon_start=1
                     /product="homeobox protein unc-4 homolog"
                     /protein_id="XP_009860233.1"
                     /db_xref="GeneID:778790"
                     /translation="

MYAPQPLVPSSMMTYPPPLYHRPSARFSLSPSAGNGGSGCPKNYYQHHVTNHAAAAAAAMYAGGAYDGFLQNYVPTDPCKQALMMASQAAGFTGMGNDYNACLDDSKPTKQRRARANYSQWQLEELERAFHTTHYPDIFMREALALRLDLIEARIQVWFQNRRAKLRRQLKMQNKTNKNDAEKNKDENSDESKSENSSVTEDVCKKGEAPVFDDVNGQGETKQDKKKR"

     misc_feature    order(1138..1152,1156..1158,1207..1209,1225..1227,
                     1264..1266,1270..1275,1282..1287,1291..1299,1303..1308)
                     /gene="LOC778790"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(1144..1146,1153..1155,1273..1275,1282..1287,
                     1294..1296)
                     /gene="LOC778790"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    1147..1305
                     /gene="LOC778790"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
ORIGIN      

ttatgtgcttaaggtgtcccgtcttacctcaccctacaatatataaacatggattgtaacagaaacttataaatcttacattttattaactgggcaaaaaacacagatttttttgaacagttttaacaccatcattacagtttctatatatataataaaacgatcgtcttcatgttaaacgttacgcatattttacattttaaatacgaaagatggttttagtttttacacctaacgaaataaataaaatatcaaatatatgtttgtgttgaaaactgttgcgttatttggaaattttaaagtgtaacttcacctgtgttcgactggatcagatttttgaaactttttctttttcttcgtcagcactcgtactcgttcttgccaactgtagcagacgcgtctggaagaggaaagccaccttcgggcagactggatgaagccgtaagcttcaagaccactaatctgatggaaagaataacatattggttaaaatttggagcaaattttagattaagtaaacatgcagtgaaatgcatatacagtcaggctgcatcagggatgttaaagacattacgaactgtatcagttattaacgtttttatttaccgttttattcaaactatttaccgttttttagcaaaaatttacaaacttattctgtttttaggttcaggaattctcatagccataatttctctttgcaaaaaaaaaatcggaatcgccattttgtaaaacgagccaagagcttatcactcactgtactggtagcgcgaagaaactcaacaacggacaatatacctcgcaatgtacgcaccccaacccttggtcccatcttcaatgatgacctacccgccaccattgtaccacagaccctcagcccggttctcactttcgccttccgcgggaaacggaggctccggatgcccgaagaattactaccaacaccacgttacgaaccatgccgctgccgccgccgctgctatgtacgctggaggtgcatatgacgggtttctgcagaattatgtcccaactgatccttgcaaacaagcgctaatgatggcatcacaagcagcagggttcactggaatgggaaacgactacaatgcttgtttagacgacagtaagcccaccaagcagcgcagagcacgtgccaactacagccaatggcagctcgaggaattggagcgagcgttccatacaacacactaccccgatattttcatgcgagaagctctggctctaagactcgatcttatagaggctcgaatacaggtttggtttcaaaacagaagagccaagctccggcgtcagttaaaaatgcaaaacaagacgaacaaaaatgacgcagagaagaacaaagatgaaaactcagatgagagcaaaagcgagaactcctccgttacagaggatgtttgcaagaaaggggaagccccggtttttgatgacgtcaacggccagggagagacgaagcaggataagaaaaaaagg

//