2024-05-05 02:15:32, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_073786 1295 bp mRNA linear INV 22-NOV-2023 DEFINITION Caenorhabditis elegans Alpha-2-macroglobulin RAP C-terminal domain-containing protein (C15C8.4), partial mRNA. ACCESSION NM_073786 VERSION NM_073786.8 DBLINK BioProject: PRJNA158 KEYWORDS RefSeq. SOURCE Caenorhabditis elegans ORGANISM Caenorhabditis elegans Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida; Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis. REFERENCE 1 (bases 1 to 1295) AUTHORS Sulson,J.E. and Waterston,R. CONSRTM Caenorhabditis elegans Sequencing Consortium TITLE Genome sequence of the nematode C. elegans: a platform for investigating biology JOURNAL Science 282 (5396), 2012-2018 (1998) PUBMED 9851916 REMARK Erratum:[Science 1999 Jan 1;283(5398):35] REFERENCE 2 (bases 1 to 1295) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (22-NOV-2023) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 1295) AUTHORS WormBase. CONSRTM WormBase Consortium TITLE Direct Submission JOURNAL Submitted (29-OCT-2023) WormBase Group, European Bioinformatics Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org REFERENCE 4 (bases 1 to 1295) AUTHORS Sulson,J.E. and Waterston,R. TITLE Direct Submission JOURNAL Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute at Washington University, St. Louis, MO 63110, USA COMMENT REVIEWED REFSEQ: This record has been curated by WormBase. This record is derived from an annotated genomic sequence (NC_003283). On Feb 2, 2021 this sequence version replaced NM_073786.7. COMPLETENESS: incomplete on the 5' end. FEATURES Location/Qualifiers source 1..1295 /organism="Caenorhabditis elegans" /mol_type="mRNA" /strain="Bristol N2" /db_xref="taxon:6239" /chromosome="V" gene <1..1295 /gene="C15C8.4" /locus_tag="CELE_C15C8.4" /db_xref="GeneID:179745" /db_xref="WormBase:WBGene00007606" CDS 1..951 /gene="C15C8.4" /locus_tag="CELE_C15C8.4" /standard_name="C15C8.4" /note="Confirmed by transcript evidence" /codon_start=1 /product="Alpha-2-macroglobulin RAP C-terminal domain-containing protein" /protein_id="NP_506187.2" /db_xref="EnsemblGenomes-Gn:WBGene00007606" /db_xref="EnsemblGenomes-Tr:C15C8.4" /db_xref="GeneID:179745" /db_xref="GOA:G5EF26" /db_xref="InterPro:IPR010483" /db_xref="InterPro:IPR036744" /db_xref="InterPro:IPR038003" /db_xref="UniProtKB/TrEMBL:G5EF26" /db_xref="WormBase:WBGene00007606" /translation="
MRNHFSFLLFLLVIGSAHNKKTQYRTERINFIYEKALQHVTDRQNLARLEKELSGYDAIYLASKSNRQGTQGTKEIDKIDDKLGKILEKYGLEKAVLAFKEKYKHKNLFQQTDDNEPLPSGKFTDQNLQKLWSQAQNGKFSQKELNALHGELKEVEQKMRVYEDQLDDFKKVPHENSIQHDIESIGDKTKKLKAANRELNDHLDEVHRKVTSEEFSPFNEPRVKRLWKLAQENEKLTPHELSVLKDELSHFESQLKKIEFHKEEVSRLQEDAEERGKDKSQVYENLELSIKHEKLNRKARKLEKYIEEKIIIHREL"
misc_feature 367..930 /gene="C15C8.4" /locus_tag="CELE_C15C8.4" /note="Alpha-2-macroglobulin RAP, C-terminal domain; Region: Alpha-2-MRAP_C; pfam06401" /db_xref="CDD:428921" misc_feature 652..948 /gene="C15C8.4" /locus_tag="CELE_C15C8.4" /note="Receptor-associated protein (RAP); Region: RAP; cl05743" /db_xref="CDD:446771" misc_feature 667..690 /gene="C15C8.4" /locus_tag="CELE_C15C8.4" /note="3-helical coiled coil [structural motif]; Region: 3-helical coiled coil" /db_xref="CDD:269812" misc_feature 718..783 /gene="C15C8.4" /locus_tag="CELE_C15C8.4" /note="3-helical coiled coil [structural motif]; Region: 3-helical coiled coil" /db_xref="CDD:269812" misc_feature 880..927 /gene="C15C8.4" /locus_tag="CELE_C15C8.4" /note="3-helical coiled coil [structural motif]; Region: 3-helical coiled coil" /db_xref="CDD:269812" ORIGIN
atgagaaatcatttttcatttctgctgtttctgctcgtcattggatcggcgcacaacaagaaaacacagtatcgaacggaacggatcaacttcatttacgaaaaggcattgcagcatgttactgatcgacaaaatttagcgaggctagagaaagagttgtccggatatgatgcgatttatctagcttctaaatcaaataggcagggaacacaaggaactaaggaaattgataaaatcgatgataaacttggcaaaattcttgagaaatatggtttggaaaaagcagttcttgcgtttaaagagaagtacaagcacaaaaacctcttccaacaaactgacgacaatgagccacttccaagtgggaaattcacagaccaaaatcttcaaaaactttggtctcaagcacaaaatggtaaattctctcaaaaagaattgaacgcattacatggagaattaaaagaagtcgaacagaaaatgcgcgtttacgaagatcaattggatgatttcaagaaagttcctcatgaaaattcaattcaacacgacattgaatcaattggtgataaaacgaaaaaattgaaagcagcaaatcgagaattaaacgatcatcttgatgaagttcaccgaaaagttacaagtgaagaattttctccattcaatgagccacgtgtaaaacgactttggaagttggctcaagaaaatgaaaaattgacgccccacgagttgagtgttctgaaagatgaattatctcattttgaaagtcagctgaagaaaatcgaattccataaggaggaagtatctcgccttcaagaagatgcagaagaacgtggaaaggataaatctcaagtttatgaaaacttggagctaagtatcaaacatgaaaaactgaatcgaaaagcgcggaaactcgaaaaatatatagaagagaaaataattatccatagagaactctagaaacccttgtgattcttcatgcaatctaatcatgtcacctatcgtatcatatcataatgagagctcatttctacctgcatttttggccataataatgataattacagacgtcgtttgattttataattcttctatttttctccattgttcttctcttgtcacgtgtatattttgttcgtaagctacttcagattgtgataattttgtactttcggtctttttttgtatttcaattgtgatagaattcatggtgctgtatctaattttattgtgatcatctgaaaccctccagcacccaaccccgcccccaaggttatacgtataaaaatcttgaaaagtatgtg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]