LOCUS       NM_001392158             900 bp    mRNA    linear   INV 22-NOV-2023
DEFINITION  Caenorhabditis elegans Homeobox protein engrailed-like ceh-16
            (ceh-16), mRNA.
ACCESSION   NM_001392158
VERSION     NM_001392158.1
DBLINK      BioProject: PRJNA158
KEYWORDS    RefSeq.
SOURCE      Caenorhabditis elegans
  ORGANISM  Caenorhabditis elegans
            Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida;
            Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae;
            Caenorhabditis.
REFERENCE   1  (bases 1 to 900)
  AUTHORS   Sulson,J.E. and Waterston,R.
  CONSRTM   Caenorhabditis elegans Sequencing Consortium
  TITLE     Genome sequence of the nematode C. elegans: a platform for
            investigating biology
  JOURNAL   Science 282 (5396), 2012-2018 (1998)
   PUBMED   9851916
  REMARK    Erratum:[Science 1999 Jan 1;283(5398):35]
REFERENCE   2  (bases 1 to 900)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (22-NOV-2023) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 900)
  AUTHORS   WormBase.
  CONSRTM   WormBase Consortium
  TITLE     Direct Submission
  JOURNAL   Submitted (29-OCT-2023) WormBase Group, European Bioinformatics
            Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org
REFERENCE   4  (bases 1 to 900)
  AUTHORS   Sulson,J.E. and Waterston,R.
  TITLE     Direct Submission
  JOURNAL   Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger
            Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute
            at Washington University, St. Louis, MO 63110, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by WormBase. This
            record is derived from an annotated genomic sequence (NC_003281).
FEATURES             Location/Qualifiers
     source          1..900
                     /organism="Caenorhabditis elegans"
                     /mol_type="mRNA"
                     /strain="Bristol N2"
                     /db_xref="taxon:6239"
                     /chromosome="III"
     gene            1..900
                     /gene="ceh-16"
                     /locus_tag="CELE_C13G5.1"
                     /db_xref="GeneID:191618"
                     /db_xref="WormBase:WBGene00000439"
     CDS             39..602
                     /gene="ceh-16"
                     /locus_tag="CELE_C13G5.1"
                     /standard_name="C13G5.1"
                     /note="Confirmed by transcript evidence"
                     /codon_start=1
                     /product="Homeobox protein engrailed-like ceh-16"
                     /protein_id="NP_001379631.1"
                     /db_xref="EnsemblGenomes-Gn:WBGene00000439"
                     /db_xref="EnsemblGenomes-Tr:C13G5.1.1"
                     /db_xref="EnsemblGenomes-Tr:C13G5.1.2"
                     /db_xref="GeneID:191618"
                     /db_xref="WormBase:WBGene00000439"
                     /translation="

MILKFGIERILSSPYPCPSPTISTPATSPSSISPTFASPNGTPNIASSMYPAWVFSTRYSDRPSAGPRHRKSRKRESTGSSGSSEEEKRPRTAFTGDQLDRLKTEFRESRYLTEKRRQELAHELGLNESQIKIWFQNKRAKLKKSTSSVPRDRCSSVTPNPHNHPSIHGGYQLMAQLAKVQARAYMP"

     misc_feature    order(300..314,318..320,369..371,387..389,426..428,
                     432..437,444..449,453..461,465..470)
                     /gene="ceh-16"
                     /locus_tag="CELE_C13G5.1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    306..467
                     /gene="ceh-16"
                     /locus_tag="CELE_C13G5.1"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    order(306..308,315..317,435..437,444..449,456..458)
                     /gene="ceh-16"
                     /locus_tag="CELE_C13G5.1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
ORIGIN      

tttgtttgagaattaatgttgatcaacaatacttagaaatgattctgaaattcggtattgaacgaatcctgtcttccccctacccttgcccatctccaactatttcaactcctgctacaagtccatcaagtatttctcctacttttgcatctccaaatggaacaccaaatattgcgtcaagtatgtatcctgcatgggtgttcagcacaagatattccgatcgaccatctgcaggccctcgacatcgaaaatcccgaaaacgagaatcaactggaagtagtggaagttcagaagaagaaaaaagaccacgtactgcattcactggagatcaattggaccggctcaaaactgaattccgggaaagcagatatctaacagaaaagcggcgacaagaattggctcacgagctcggactcaacgaatcgcagatcaaaatctggttccagaacaagcgtgccaaactcaaaaagtcgacatcttctgttccaagagatcgatgctcctccgtcactccaaatcctcataatcatccgtcaattcatggaggatatcaacttatggctcagttggcaaaggttcaggctcgagcttacatgccatgaaatattgatttttgttaggcggttacggtaggccttgtctaccgtaatcctaaagtatcccggtaataactttctagttactttatcaaattagtgatattctcctctagccaactagtcttcctccattcattttttttcgtttaactttttctctcgaccagatcttatttgaaatcgaaatacctcaacattcagttctccaaaaaaatcaaaatttcctccacacacgtgtctcctcttcaatgctatatgaattatctcatgacttttcattgtttttcttttttgaataaag

//