LOCUS       NM_001383707            3105 bp    mRNA    linear   INV 22-NOV-2023
DEFINITION  Caenorhabditis elegans Protein argonaute-2 (alg-5), mRNA.
ACCESSION   NM_001383707
VERSION     NM_001383707.1
DBLINK      BioProject: PRJNA158
KEYWORDS    RefSeq.
SOURCE      Caenorhabditis elegans
  ORGANISM  Caenorhabditis elegans
            Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida;
            Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae;
            Caenorhabditis.
REFERENCE   1  (bases 1 to 3105)
  AUTHORS   Sulson,J.E. and Waterston,R.
  CONSRTM   Caenorhabditis elegans Sequencing Consortium
  TITLE     Genome sequence of the nematode C. elegans: a platform for
            investigating biology
  JOURNAL   Science 282 (5396), 2012-2018 (1998)
   PUBMED   9851916
  REMARK    Erratum:[Science 1999 Jan 1;283(5398):35]
REFERENCE   2  (bases 1 to 3105)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (22-NOV-2023) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 3105)
  AUTHORS   WormBase.
  CONSRTM   WormBase Consortium
  TITLE     Direct Submission
  JOURNAL   Submitted (29-OCT-2023) WormBase Group, European Bioinformatics
            Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org
REFERENCE   4  (bases 1 to 3105)
  AUTHORS   Sulson,J.E. and Waterston,R.
  TITLE     Direct Submission
  JOURNAL   Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger
            Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute
            at Washington University, St. Louis, MO 63110, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by WormBase. This
            record is derived from an annotated genomic sequence (NC_003279).
FEATURES             Location/Qualifiers
     source          1..3105
                     /organism="Caenorhabditis elegans"
                     /mol_type="mRNA"
                     /strain="Bristol N2"
                     /db_xref="taxon:6239"
                     /chromosome="I"
     gene            1..3105
                     /gene="alg-5"
                     /locus_tag="CELE_T23D8.7"
                     /db_xref="GeneID:172861"
                     /db_xref="WormBase:WBGene00011945"
     CDS             3..2720
                     /gene="alg-5"
                     /locus_tag="CELE_T23D8.7"
                     /standard_name="T23D8.7"
                     /note="Confirmed by transcript evidence"
                     /codon_start=1
                     /product="Protein argonaute-2"
                     /protein_id="NP_001370006.1"
                     /db_xref="EnsemblGenomes-Gn:WBGene00011945"
                     /db_xref="EnsemblGenomes-Tr:T23D8.7"
                     /db_xref="GeneID:172861"
                     /db_xref="GOA:Q9XVI3"
                     /db_xref="InterPro:IPR003100"
                     /db_xref="InterPro:IPR003165"
                     /db_xref="InterPro:IPR012337"
                     /db_xref="InterPro:IPR014811"
                     /db_xref="InterPro:IPR032472"
                     /db_xref="InterPro:IPR032473"
                     /db_xref="InterPro:IPR032474"
                     /db_xref="InterPro:IPR036085"
                     /db_xref="InterPro:IPR036397"
                     /db_xref="UniProtKB/TrEMBL:Q9XVI3"
                     /db_xref="WormBase:WBGene00011945"
                     /translation="

MEDQWLLSAIYDDDLVEKLKVRSSTSSRSTSINVPSLENEFLSSSSGSRVSDDLYLHPIEENREPFKLIGKPLPSTTGRFLSLLANHFQITCNGSIIHQYYIRFDPDIPSKKLNRTILRTLQEQNPGLIECPLVFDGIHTVYSTELINVKEVNNSVINVAGVVNTKESPNLFKLYLTHVDSFLLDTKIITGNQDQNQKLRMMHAIDTVFRQTSTGNFHAVLQSFFSIAQNSAIEPSHGLGWGTVNLGVGREVCYGFYQNVVETFDTLTMNLDVATTTFYRPVALVEFLAEILEVPLATVTDGRSLSDVQKKKFNREVAGLKVETRHCSCPRRFRVARCTWKPTENISFHLSETAGNQDSKPLSLVEYYKRRYNIDLTYKHLPCIEVGRTRECILPLELCYVVSGQRCIKKLNEQQIANLIRATSRNATERQNAVMSLQNRLKMDNDVNAVKFGLKVEAQLLKIEGRVLPVPRLLYRSPNLKRQECVTVPNNGTWDMRGKNFYSGIQIREWAIVCFASPEIIGEASMRSFVRNLVNVASEIGMPFLEEHRFCRYAEPDQTVKLLEHLNEQYNLQLVLCIVPGKSVVYGELKRKGELLGLTTQCVRSQNVSKASPHTLSNLCMKINSKLGGINVILSSPPQSLNSEPVLFIGCHLTRSSLASSSDSTSSIAHCDSSIACLVGSMDGHPTQFSPIFRTQPRHQRTIVDMCEMTREAIINFRKSTGFKPHKIIIYRAGIADVTVDEIMQTELRAVRDACAMIEYGFQPGITFIGLDVTHHTRLFAANEKDRVGNSQNVPAGTLVETGITVNNLFEFYLVSHAGIQGTSRPTKYVVMWDDNSIPSADIHEMTYQLCHTQSRCTRSVSIPSPVYYAKLVAQRAKILMADENFDMERFRLCGIGRNDGMSFT"

     misc_feature    657..842
                     /gene="alg-5"
                     /locus_tag="CELE_T23D8.7"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    915..1262
                     /gene="alg-5"
                     /locus_tag="CELE_T23D8.7"
                     /note="PAZ domain; Region: PAZ; pfam02170"
                     /db_xref="CDD:426635"
     misc_feature    order(999..1001,1044..1046,1092..1094,1104..1106,
                     1158..1160,1176..1178,1182..1184)
                     /gene="alg-5"
                     /locus_tag="CELE_T23D8.7"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1344..2645
                     /gene="alg-5"
                     /locus_tag="CELE_T23D8.7"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1758..1760,1770..1772,1803..1814,1821..1823,
                     1845..1847,1854..1856,1866..1868,1878..1880)
                     /gene="alg-5"
                     /locus_tag="CELE_T23D8.7"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1956..1958,1962..1964,2199..2201,2613..2615)
                     /gene="alg-5"
                     /locus_tag="CELE_T23D8.7"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      

gtatggaagaccaatggttgctgtcggcaatttatgatgatgatttggtcgaaaagttaaaagtgaggagttccacttcatcaagaagtacttcgatcaacgtgcccagtttggaaaatgagtttctcagcagttcttctggatccagagtttccgatgatctctacctgcatcctattgaagaaaacagagagccattcaaattgataggaaagccacttcccagcactacaggacgattcttatcacttctcgccaatcattttcaaatcacgtgcaatggatcgattattcatcaatactatattcgattcgatccagatattccgtcgaaaaagctgaacagaacgattttgagaactctgcaagaacagaatcccggacttatcgagtgcccgttagttttcgatggaattcacactgtgtactcaacagagctgattaatgtcaaggaagtgaataattcagtcatcaatgttgcaggagttgttaatacaaaagaatcacctaatctattcaaactctatctaacacatgtcgacagcttcctcttggatactaaaattatcacaggaaatcaggatcagaaccagaagttgcgaatgatgcatgcaattgatactgtcttccgtcaaacttctactggaaatttccatgccgtgcttcaatctttcttctcaattgcacaaaattctgcaatcgaaccctcgcatggccttggatggggaactgtcaatttaggagttggacgagaagtttgctacggtttttatcaaaatgttgttgagacattcgatacactcactatgaatctcgacgttgcaacaactacattctaccgccccgtggctctcgtggaattccttgctgaaattctggaagttccactggcaacagtcaccgacggacgttcgctgagcgatgttcaaaagaaaaagttcaaccgtgaagtggccggactcaaagttgaaaccagacactgtagttgtccacgaagatttcgtgtcgcccgttgcacttggaaaccaactgaaaatattagtttccatctctccgagactgccggcaatcaagattctaaacctctctcattggttgaatactataaaaggcgttataatatcgatctgacatataagcatcttccgtgtattgaagttggacgcactcgagaatgtattcttcctttggagctttgttacgtagtcagtggccaacgatgtatcaagaaactgaatgaacaacagattgcaaatctgatcagagcaacgagccgaaatgcaactgaacgacaaaatgcagtcatgagccttcagaatcggctgaaaatggataatgatgtcaatgcggttaaatttggattaaaagttgaagctcaattgttgaagattgaaggacgtgtcttgccggttccgcgtcttctctatcgttccccaaatttgaagagacaagagtgtgtaacagttccgaataatggaacatgggatatgagaggaaagaatttttacagcggaatccagattcgagaatgggcaattgtttgtttcgcaagcccagagattatcggagaagccagcatgcgttcatttgtcagaaatctcgtcaatgttgcctctgaaattggaatgccttttctcgaagaacaccgattctgcagatacgcagaaccagaccagactgtgaagcttctcgaacatttgaatgaacaatacaatcttcaactcgttttatgcattgtccccggaaaatctgtagtttatggagaattgaaacgaaaaggagagctacttggtttgacaactcaatgtgttcgatctcaaaatgtttcgaaagcgtcaccacacactctttctaatctctgtatgaaaatcaactcgaaactcggaggcattaatgtaatcctatcctctcctccacaatctctaaattctgaaccagtactttttatcggatgtcatttaactcgaagttcactcgcctcatcttctgattccacatcttctatagctcattgtgattcctccatcgcttgtctcgtcggttcaatggatggacatcctactcagttttctccaatctttcgtactcaaccacgtcatcaaagaactattgtcgatatgtgtgaaatgacacgtgaagctattatcaatttccgaaagtctacaggatttaaaccccacaaaattatcatttatcgtgctggaatcgcagatgtgactgtcgatgaaatcatgcaaacggaattacgtgctgtacgggatgcatgtgctatgatcgaatacggtttccagccaggaatcacttttattgggttagatgtcactcatcatacgagactttttgcagctaatgaaaaagatcgcgtcggaaatagtcaaaatgtgccagctggaactctcgtggaaacaggaatcactgtgaataatctcttcgagttctacctcgtatcacatgcaggaattcaaggaacttctcgcccgacgaagtatgttgtcatgtgggacgataattcaataccatctgccgatattcatgagatgacctatcagctatgtcacactcaatccagatgcacaagaagcgtctccattccttcgccagtatactatgcaaaattagtagctcaacgagcaaaaatattgatggctgatgagaattttgatatggaacgattccgtttgtgtggaattggtcggaacgatggaatgtcattcacctaattctacgtcatttacatttcaacttactcgtcatttacatcatactcacccgaaatgcgggtcttttaaaaagtcatttatctatttattttctcatttttcacactagtttacagatattcaatatcccatttttctaatagtcaatccacgatgtcgttcttattgttatattttgttgttacagtccaccttttcatagatcttgttctcaattatacggttccggacaaatacttgttactttttgttgttgtcatacatttttgttacaattttccattttttgttgttttctattttcgtgccaatatttgtgagtttttattttgcgtgctaagcagcgtttctcagaataattatgataaagaataaggaacgggca

//