2024-04-28 09:07:37, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001356812 22827 bp mRNA linear INV 22-NOV-2023 DEFINITION Caenorhabditis elegans Muscle M-line assembly protein unc-89 (unc-89), partial mRNA. ACCESSION NM_001356812 VERSION NM_001356812.3 DBLINK BioProject: PRJNA158 KEYWORDS RefSeq. SOURCE Caenorhabditis elegans ORGANISM Caenorhabditis elegans Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida; Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis. REFERENCE 1 (bases 1 to 22827) AUTHORS Sulson,J.E. and Waterston,R. CONSRTM Caenorhabditis elegans Sequencing Consortium TITLE Genome sequence of the nematode C. elegans: a platform for investigating biology JOURNAL Science 282 (5396), 2012-2018 (1998) PUBMED 9851916 REMARK Erratum:[Science 1999 Jan 1;283(5398):35] REFERENCE 2 (bases 1 to 22827) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (22-NOV-2023) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 22827) AUTHORS WormBase. CONSRTM WormBase Consortium TITLE Direct Submission JOURNAL Submitted (29-OCT-2023) WormBase Group, European Bioinformatics Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org REFERENCE 4 (bases 1 to 22827) AUTHORS Sulson,J.E. and Waterston,R. TITLE Direct Submission JOURNAL Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute at Washington University, St. Louis, MO 63110, USA COMMENT REVIEWED REFSEQ: This record has been curated by WormBase. This record is derived from an annotated genomic sequence (NC_003279). On Apr 15, 2020 this sequence version replaced NM_001356812.2. COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..22827 /organism="Caenorhabditis elegans" /mol_type="mRNA" /strain="Bristol N2" /db_xref="taxon:6239" /chromosome="I" gene <1..>22827 /gene="unc-89" /locus_tag="CELE_C09D1.1" /db_xref="GeneID:171990" /db_xref="WormBase:WBGene00006820" CDS 1..22827 /gene="unc-89" /locus_tag="CELE_C09D1.1" /standard_name="C09D1.1g" /note="Partially confirmed by transcript evidence" /codon_start=1 /product="Muscle M-line assembly protein unc-89" /protein_id="NP_001343617.1" /db_xref="GeneID:171990" /db_xref="WormBase:WBGene00006820" /translation="
MVLKTLYIIELTDTEEGGLELVDPSWCPEEGGPPRKKVKSPPVISPTGSSTSIYSGGSSSIDWTTTGTTLEMQGTRVTRTQYGFRTLQESSAKMCLKVTGYPLPDITWYKDDVQLHEDERHTFYSDEDGFFAMTIDPVQVTDTGRYTCMATNEYGQASTSAFFRVLKVEKEAAPPAFVTKLRDKECKEGDVIDFECEVEGWPEPELVWLVDDQPLRPSHDFRLQYDGQTAKLEIRDAQPDDTGVYTVKIQNEFGSIESKAELFVQADPDKNHVAPEFQATIEYVECDEGEEVRFKSVITGDPNPEIIWFINGKPLSESEKVKFISEDGICILTIKDVTRHFDGMVTCQGSNRLGSASCDGRLKVRVPPAPPTFNKPLEDKTVQEKSTVVFEVDVSGWPEPTLTFTLCGKELKNGEEGVEIVGHDGFYRISIPNTSMDKHDGEIVAKAQNEHGTAESRARLTVEQEEEESRSAPTFLKDIEDQTVKTGEFAVFETTVRGNPNPEVTWFINGHKMDQGSPGVKIEAHNHDHKLTIDSAQYAGTVLCRAENAVGRFETKARLVVLAPEKQKKPPKFVEILVDKTETVDNTVVFEVRVEGEPKPTVTWYLKGEELKQSDRVEIREFDGSIKISIKNIKIEDAGEIRAVATNSEGSDETKAKLTVQKKPFAPEFDLRPVSLTVEKGSEAVFSAHAFGIPLPTYEWSVNGRKVRDGQEGARVTRDESTVDGASILTIDTATYYSEVNHLTISVVAENTLGAEETGAQLTIEPKKESVVVEKQDLSSSEVQKEIAQQVKEASPEATTTITMETSLTSTKTTTMSTTEVTSTVGGVTVETKESESESATTVIGGGSGGVTEGSISVSKIEVVSKTDSQTDVREGTPKRRVSFAEEELPKEVIDSDRKKKKSPSPDKKEKSPEKTEEKPASPTKKTGEEVKSPKEKSPASPTKKEKSPAAEEVKSPTKKEKSPSSPTKKEKSPSSPTKKTGDEVKEKSPPKSPTKKEKSPEKPEDVKSPVKKEKSPDATNIVEVSSETTIEKTETTMTTEMTHESEESRTSVKKEKTPEKVDEKPKSPTKKDKSPEKSITEEIKSPVKKEKSPEKVEEKPASPTKKEKSPEKPASPTKKSENEVKSPTKKEKSPEKSVVEELKSPKEKSPEKADDKPKSPTKKEKSPEKSATEDVKSPTKKEKSPEKVEEKPTSPTKKESSPTKKTDDEVKSPTKKEKSPQTVEEKPASPTKKEKSPEKSVVEEVKSPKEKSPEKAEEKPKSPTKKEKSPEKSAAEEVKSPTKKEKSPEKSAEEKPKSPTKKESSPVKMADDEVKSPTKKEKSPEKVEEKPASPTKKEKTPEKSAAEELKSPTKKEKSPSSPTKKTGDESKEKSPEKPEEKPKSPTPKKSPPGSPKKKKSKSPEAEKPPAPKLTRDLKLQTVNKTDLAHFEVVVEHATECKWFLDGKEITTAQGVTVSKDDQFEFRCSIDTTMFGSGTVSVVASNAAGSVETKTELKVLETPKETKKPEFTDKLRDMEVTKGDTVQMDVIALHSPLYKWYQNGNLLEDGKNGVTIKNEENKSSLIIPNAQDSGKITVEASNEVGSSESSAQLTVNPPSTTPIVVDGPKSVTIKETETAEFKATISGFPAPTVKWTINEKIVEESRTITTIKTEDVYTLKISNAKIEQTGTVKVTAQNSAGQDSKQADLKVEPNVKAPKFKSQLTDKVADEGEPLRWNLELDGPSPGTEVSWLLNGQPLTKSDTVQVVDHGDGTYHVTIAEAKPEMSGTLTAKAKNAAGECETSAKVTVNGGNKKPEFVQAPQNHETTLEESVKFSAIVTGKPMPNVTWYLNNKKLIQSEEVKVKYVHETGKTSIRIQKPLMEHNGTIRVEAENVSGKVQATAQLKVDKKTEVPKFTTNMDDRQVKEGEDVKFTANVEGYPEPSVAWTLNGEPVSKHPNITVTDKDGEHTIEISAVTPEQAGELSCEATNPVGSKKRDVQLAVKKVGDAPTFAKNLEDRLITEGELTLMDAKLNIVKPKPKITWLKDGVEITSDGHYKIVEEEDGSLKLSILQTKLEDKGRITIKAESEFGVAECSASLGVVKGRPMAKPAFQSDIAPINLTEGDTLECKLLITGDPTPFVKWYIGTQLVCATEDTEISNANGVYTMKIHGVTADMTGKIKCVAYNKAGEVSTEGPLKVVAPIPVEFETSLCDATCREGDTLKLRAVLLGEPEPVVSWYVNGKKLEESQNIKIHSEKGTYTVTIKDITCDYSGQVVCEAINEYGKATSEATLLVLPRGEPPDFLEWLSNVRARTGTKVVHKVVFTGDPKPSLTWYINNKEILNSDLYTIVTDDKTSTLTINSFNPDVHVGEIICKAENDAGEVSCTANMITYTSDMFSESESEAQAEEFVGDDLTEDESLREEMHRTPTPVMAPKFITKIKDTKAKKGHSAVFECVVPDTKGVCCKWLKDGKEIELIARIRVQTRTGPEGHITQELVLDNVTPEDAGKYTCIVENTAGKDTCEATLTVIESLEKKSEKKAPEFIVALQDKTTKTSEKVVLECKVIGEPKPKVSWLHDNKTITQESITVESVEGVERVTITSSELSHQGKYTCIAENTEGTSKTEAFLTVQGEAPVFTKELQNKELSIGEKLVLSCSVKGSPQPHVDFYSFSETTKVETKITSSSRIAIEHDQTNTHWRMVISQITKEDIVSYKAIATNSIGTATSTSKITTKVEAPVFEQGLKKTSVKEKEEIKMEVKVGGSAPDVEWFKDDKPVSEDGNHEMKKNPETGVFTLVVKQAATTDAGKYTAKASNPAGTAESSAEAEVTQSLEKPTFVRELVTTEVKINETATLSVTVKGVPDPSVEWLKDGQPVQTDSSHVIAKVEGSGSYSITIKDARLEDSGKYACRATNPAGEAKTEANFAVVKNLVPPEFVEKLSPLEVKEKESTTLSVKVVGTPEPSVEWFKDDTPISIDNVHVIQKQTAVGSFSLTINDARQGDVGIYSCRARNEAGEALTTANFGIIRDSIPPEFTQKLRPLEVREQETLDLKVTVIGTPVPNVEWFKDDKPINIDNSHIFAKDEGSGHHTLTIKQARGEDVGVYTCKATNEAGEAKTTANMAVQEEIEAPLFVQGLKPYEVEQGKPAELVVRVEGKPEPEVKWFKDGVPIAIDNQHVIEKKGENGSHTLVIKDTNNADFGKYTCQATNKAGKDETVGELKIPKYSFEKQTAEEVKPLFIEPLKETFAVEGDTVVLECKVNKESHPQIKFFKNDQPVEIGQHMQLEVLEDGNIKLTIQNAKKEDVGAYRCEAVNVAGKANTNADLKIQFAAKVEEHVTDESGQLEEIGQFETVGDTASSKTDTGRGAPEFVELLRSCTVTEKQQAILKCKVKGEPRPKIKWTKEGKEVEMSARVRAEHKDDGTLTLTFDNVTQADAGEYRCEAENEYGSAWTEGPIIVTLEGAPKIDGEAPDFLQPVKPAVVTVGETAVLEGKISGKPKPSVKWYKNGEELKPSDRVKIENLDDGTQRLTVTNAKLDDMDEYRCEASNEFGDVWSDVTLTVKEPAQVAPGFFKELSAIQVKETETAKFECKVSGTKPDVKWFKDGTPLKEDKRVHFESTDDGTQRLVIEDSKTDDQGNYRIEVSNDAGVANSKVPLTVVPSETLKIKKGLTDVNVTQGTKILLSVEVEGKPKTVKWYKGTETVTSSQTTKIVQVTESEYKLEIESAEMSDTGAYRVVLSTDSFSVESSATVTVTKAAEKISLPSFKKGLADQSVPKGTPLVLEVEIEGKPKDVKWYKNGDEIKDGKVEDLGNGKYRLTIPDFQEKDVGEYSVTAANEAGEIESKAKVNVSAKPEIVSGLVPTTVKQGETATFNVKVKGPVKGVKWYKNGKEIPDAKTKDNGDGSYSLEIPNAQVEDAADYKVVVSNDAGDADSSAALTVKLADDGKDKVKPEIVSGLIPTTVKQGETATFNVKVKGPVKQVKWYKNGKEIPNAKAKDNGDGSYSLEIPNAQLDDTADYKVVVSNDAGDADSSAALTVKLPGIAIVKGLEDAEVPKGKKAVLQVETNKKPKEIKWYKNGKEITPSDKAQPGSDGDNKPQLVIPDAGDDDAAEYKVVLTDEDGNTADSSCALTVKLPAKEPKIIKGLEDQVVSIGSPIKLEIETSGSPKTVKWYKNGKELPGAAAKTIKIQKIDDNKYVLEIPSSVVEDTGDYKVEVANEAGSANSSGKITVEPKITFLKPLKDQSITEGENAEFSVETNTKPRIVKWYKNGQEIKPNSRFIIEQKTDTKYQLVIKNAVRDDADTYKIVLENTAGEAESSAQLTVKKAKAGLCKIVKGLEDQVVAKGAKMVFEVKIQGEPEDVRWLRDANVISAGANAIIEKIDDTTYRLIIPSADLKDAGEYTVEVINESGKAKSDAKGEVDEKPEIVRGLENIEIPEGDDDVFKVEVSAPVRQVKWYKNDQEIKPNSHLEAKKIGPKKYELAINRAQLDDGADYKVVLSNAAGDCDSSAALTVVKPNVLKIVDGLKDVDVEEPQPVELKVKVEGIPKVIKWYKNGQELKPDADGFKFEEKPESGEFSLTIPSSKKSDGGAYRVVLGNDKGEVYSGSVVHVKSAKSSEPTSGANFLSPLKDTEVEEGDMLTLQCTIAGEPFPEVIWEKDGVVLQKDDRITMRVALDGTATLRIRSAKKSDIGQYRVTAKNEAGSATSDCKVTVTEQGEQPSKPKFVIPLKTGAALPGDKKEFNVKVRGLPKPTLQWFLNGIPIKFDDRITLDDMADGNYCLTIRDVREEDFGTLKCIAKNENGTDETVCEFQQGAGHDDGSRDDLRYPPRFNVPLWDRRIPVGDPMFIECHVDANPTAEVEWFKDGKKIEHTAHTEIRNTVDGACRIKIIPFEESDIGVYMCVAVNELGQAETQATYQVEILEHVEEEKRREYAPKINPPLEDKTVNGGQPIRLSCKVDAIPRASVVWYKDGLPLRADSRTSIQYEEDGTATLAINDSTEEDIGAYRCVATNAHGTINTSCSVNVKVPKQEVKKEGEEPFFTKGLVDLWADRGDSFTLKCAVTGDPFPEIKWYRNGQLLRNGPRTVIETSPDGSCSLTVNESTMSDEGIYRCEAENAHGKAKTQATAHVQMALGKTEKPKMDEGKPPKFILELSDMSVSLGNVIDLECKVTGLPNPSVKWSKDGGPLIEDSRFEWSNEASKGVYQLRIKNATVHDEGTYRCVATNENGSATTKSFVRMDDGLGSGVVTASQPPRFTLKMGDVRTTEGQPLKLECKVDASPLPEMVWYKDGAIVTPSDRIQISLSPDGVATLLIPSCVYDDDGIYRVIATNPSGTAQDKGTATVKKLPRDSGARRSADRDVFDANKAPKLMEPLENIRIPEKQSFRLRCKFSGDPKPTIKWFKDGERVFPYGRLQLIESPDGVCELVVDSATRQDAGGYRCVAENTYGSARTSCDVNVIRGDRKPRDIDSSIREGKAPGFTTPLTIRRAKPGDSVTFECLPFGNPFPSIKWLKDGLELFSDEKIKMEAAADGTQRLILSDVTFLSEGYFRCVATNEHGTASTKAELVIEGDRTIGSRPLPEVNGEPEECKPRIRRGLYNMSIHEGNVVEMIVCATGIPTPTVKWYKDGQEIVGDGPDGKRVIFTDERGIHHLVIVNASPDDEGEYSLEATNKLGSAKTEGSLNIIRPRHIADADERGGMPFPPGFVRQLKNKHVFNHMPTIFDCLVVGHPAPEVEWFHNGKKIVPGGRIKIQSCGGGSHALIILDTTLEDAGEYVATAKNSHGSASSSAVLDVTVPFLDSIKFNGEIDVTPYLTEEYGFKKLNTASLPTPPDRGPFIKEVTGHYLTLSWIPTKRAPPRYPQVTYVIEIRELPEKQWSLLEYNIPEPVCKVRNLELGKSYQFRVRAENIYGISDPSPASPPSRLMAPPQPVFDRRTNKVIPLLDPYAEKALDMRYSEQYACAPWFSPGVVEKRYCAENDTLTIVLNVSGFPDPDIKWKFRGWDIDTSSPTSKCKVYTYGGSETTLAITGFSKENVGQYQCFAKNDYGDAQQNIMVDLATRPNFIQPLVNKTFSSAQPMRMDVRVDGEPFPELKWMKEWRPIVESSRIKFVQDGPYLCSLIINDPMWRDSGIYSCVAVNDAGQATTSCTVTVEAEGDYNDVELPRRRVTIESRRVRELYEISEKDEKLAAEGAPFRVKEKATGREFLAQLRPIDDALMRHVDIHNSLDHPGIVQMHRVLRDEKLALVVFDNANSTIDGLSSLAHPGVEIAEPKGVNRETCVRVFVRQLLLALKHMHDLRIAHLDLRPETILLQDDKLKLADFGQARRLLRGLITGEIKGSPEFVSPEIVRSYPLTLATDMWSTGVLTYVLLTGLSPFHGDNDNETLANVDSCQFDSSPLGNFSYDAGDFVKKLLTEIPVSRLTVDEALDHPWINDEKLKTEPLSADTLREFKYQHKWLERRVFVQQTPSEQILEAILGPATAQAQQNAPVAPEGRRPAEIYDYLRIQPKKPPPTVEYVPQPRKEHPPFIDEFGQLIDGDAFDRPEGTGFEGPHRQPPQIPPQPQRPNQAAHDSRRHEQQPQHQGQPQRIPVDQYGRPLVDPRYLNDPSHRPSSLDDAPFYVDKYGNPVHFDKYGRPMAPQNLEKRKLIPQDKGETPSHSKKEKTQHPVATPILASPGGDQQQQKIPMRMIRGERREIEEEIANRILSDISEEGSIAGSLASLEDFEIPKDFQVEASEPSTPTLTPEVTIRETIPKPTPSPTSPQKSPVPQPQGLLIPAKVTYSDSILAGLPAADKKVLEDAENDPSIPVGAPLFLEGLHGSDLTIDTTSASGLIKVTSPAINLSPNPKSPRRSTPGTKSPVVLSPRQEHSMEVLIATKRGKPGFLPPGELAEDIDDEDAFMDDRKKQVKPKDHDGENDFKDEKERLEKDKNRRTVNLDDLDKYRPSAFYKDDSDFGHPGYDIDATPWDSHYQIGPDTYLMAARGAAFNSRVRNYREELFGMGAPTVKQGFLGVRNRDITVRERRRYTDILRETTQGLEPKSHEQSTALLQKAPSATAIERIKADIEKVTPCATKKNDDGTFAPIFTARLRDVYLRKNQPAIFECAVSASPAPKVTWDFQGKILESNDRVTIEQDNNVARLILNHAAPYDLGEYVCTAINEYGTDKSSCRLISGETPSRPGRPEAELSSDTEIFIQWEAPEGPTYLEGITYRLEYRVAGPNDHGDPWITVSEKIDDESVIVKHLSPLGIYQFRVTAQNGFGLGLPSLSSRIVQTHGKGAPKLQIDVLKSEIRLNVVSMPQKSTNQLGGISEESEEDSEARTANEDMKSNLQLQTDDPTGRFQIGGLKFKGRFSVIRDAVDSTTEGHAHCAVKIRHPSSEAISEYESLRDGQHENVQRLIAAFNNSNFLYLLSERLYEDVFSRFVFNDYYTEEQVALTMRQVTSALHFLHFKGIAHLDVNPHNIMFQSKRSWVVKLVDFGRAQKVSGAVKPVDFDTKWASPEFHIPETPVTVQSDMWGMGVVTFCLLAGFHPFTSEYDREEEIKENVINVKCDPNLIPVNASQECLSFATWALKKSPVRRMRTDEALSHKFLSSDPSMVRRRESIKYSASRLRKLAAMIRQPTFSQPISEELESKYGK"
misc_feature 274..288 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature <289..495 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 313..327 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 391..405 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 433..450 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 472..483 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 523..792 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 574..588 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 613..627 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 688..702 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 730..747 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 769..780 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 823..1092 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 874..888 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 913..927 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 988..1002 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1030..1047 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1069..1080 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1111..1386 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1162..1176 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1201..1215 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1279..1293 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1324..1341 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1363..1374 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1417..1683 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1468..1482 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1507..1521 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1585..1599 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1609..1638 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1660..1671 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1711..1980 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 1762..1776 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1801..1815 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1876..1890 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1918..1935 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1957..1968 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1999..2292 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 2050..2064 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2089..2103 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2179..2193 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 2203..2247 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 2269..2280 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature <2614..4557 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="MAEBL; Provisional; Region: PTZ00121" /db_xref="CDD:173412" misc_feature 4525..4785 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 4576..4590 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 4609..4623 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 4687..4701 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 4723..4740 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 4762..4773 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 4822..5073 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 4855..4869 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 4894..4908 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 4969..4983 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 5011..5028 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 5050..5061 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 5092..5367 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 5143..5157 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 5185..5199 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 5257..5277 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 5305..5322 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 5344..5355 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 5386..5661 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 5437..5451 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 5476..5490 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 5557..5571 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 5599..5616 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 5638..5649 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 5680..5949 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 5731..5745 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 5770..5784 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 5845..5859 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 5887..5904 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 5926..5937 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 5968..6243 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 6019..6033 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 6061..6075 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6139..6153 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6181..6198 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6220..6231 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 6268..6537 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 6358..6372 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6433..6447 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6475..6492 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6514..6525 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 6556..6822 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 6604..6618 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 6643..6657 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6718..6732 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6760..6777 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6799..6810 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 6841..7110 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 6931..6945 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 7006..7020 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 7051..7068 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 7090..7101 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 7240..7524 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 7291..7305 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 7330..7344 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 7420..7434 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 7462..7479 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 7501..7512 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 7561..7827 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 7612..7626 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 7651..7665 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 7717..7737 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 7765..7782 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 7804..7815 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 7840..8130 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 7891..7905 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 7930..7944 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 8026..8043 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 8071..8088 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 8146..8418 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 8197..8211 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 8233..8247 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 8314..8328 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 8356..8373 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 8395..8406 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 8437..8712 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 8488..8502 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 8527..8541 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 8608..8622 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 8650..8667 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 8689..8700 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 8731..8997 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 8782..8796 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 8821..8835 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 8902..8916 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 8944..8961 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 8983..8994 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 9025..9300 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 9076..9090 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 9115..9129 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 9196..9210 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 9238..9255 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 9277..9288 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 9319..9594 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 9370..9384 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 9409..9423 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 9490..9504 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 9532..9549 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 9571..9582 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 9637..9909 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 9688..9702 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 9727..9741 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 9805..9819 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 9847..9864 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 9886..9897 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 10030..10287 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 10081..10095 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 10120..10134 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10198..10212 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 10240..10257 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 10279..10290 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 10339..10611 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 10390..10404 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 10429..10443 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10501..10521 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 10549..10566 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 10588..10599 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 10633..10902 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 10684..10698 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 10720..10734 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10798..10812 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 10840..10857 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 10879..10890 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 10921..11187 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 10969..10983 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11005..11019 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 11125..11142 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 11164..11175 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 11215..11475 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 11266..11280 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11302..11316 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 11371..11385 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 11413..11430 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 11452..11463 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 11485..11745 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 11536..11550 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11572..11586 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 11641..11655 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 11683..11700 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 11722..11733 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 11779..12039 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 11830..11844 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11866..11880 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 11935..11949 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 11977..11994 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12016..12027 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12058..12327 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 12103..12117 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12139..12153 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12217..12231 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 12259..12276 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12301..12312 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12343..12618 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 12394..12408 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12430..12444 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12514..12528 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 12556..12573 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12595..12606 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12634..12897 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 12679..12693 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12715..12729 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12793..12807 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 12835..12852 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12874..12885 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12922..13188 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 12970..12984 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 13009..13020 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 13084..13098 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 13126..13143 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 13165..13176 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 13198..13467 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 13249..13263 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 13285..13299 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 13363..13377 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 13405..13422 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 13444..13455 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 13516..13761 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 13534..13548 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 13570..13584 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 13654..13668 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 13696..13713 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 13735..13746 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 13798..14064 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 13843..13857 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 13882..13896 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 13960..13974 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 14002..14019 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 14041..14052 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 14092..14361 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 14143..14157 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 14182..14196 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 14260..14274 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 14302..14319 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 14347..14358 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 14410..14682 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 14461..14475 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 14500..14514 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 14578..14592 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 14620..14637 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 14659..14670 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 14728..15000 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 14779..14793 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 14818..14832 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 14896..14910 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 14938..14955 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 14977..14988 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 15040..15312 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 15091..15105 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 15130..15144 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 15208..15222 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 15250..15267 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 15292..15303 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 15364..15633 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 15454..15468 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 15529..15549 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 15577..15594 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 15619..15630 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 15682..15954 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 15733..15747 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 15772..15786 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 15850..15864 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 15892..15909 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 16024..16296 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 16075..16089 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 16114..16128 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 16192..16206 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 16234..16251 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 16273..16284 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 16354..16626 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 16405..16419 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 16444..16458 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 16522..16536 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 16564..16581 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 16603..16614 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 16693..16974 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 16744..16758 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 16783..16797 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 16870..16884 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 16912..16929 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 16951..16962 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 17029..17301 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 17080..17094 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 17119..17133 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 17197..17211 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 17239..17256 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 17278..17289 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 17404..17655 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Fibronectin type 3 domain; Region: FN3; smart00060" /db_xref="CDD:214495" misc_feature order(17404..17406,17605..17607,17650..17652) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Interdomain contacts [active]" /db_xref="CDD:238020" misc_feature <17878..18066 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 17899..17913 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 17986..18000 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 18028..18045 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 18109..18372 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="immunoglobulin-like domain of telokin and similar proteins; a member of the I-set of IgSF domains; Region: IgI_telokin-like; cd20973" /db_xref="CDD:409565" misc_feature 18109..18120 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand A [structural motif]; Region: Ig strand A" /db_xref="CDD:409565" misc_feature 18124..18135 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand A' [structural motif]; Region: Ig strand A'" /db_xref="CDD:409565" misc_feature 18145..18174 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409565" misc_feature 18187..18207 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409565" misc_feature 18214..18222 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C' [structural motif]; Region: Ig strand C'" /db_xref="CDD:409565" misc_feature 18238..18255 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand D [structural motif]; Region: Ig strand D" /db_xref="CDD:409565" misc_feature 18262..18288 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409565" misc_feature 18310..18333 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409565" misc_feature 18340..18372 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409565" misc_feature 18439..19215 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Pseudokinase domain, first repeat, of the Giant Serine/Threonine Kinase Uncoordinated protein 89; Region: PK_Unc-89_rpt1; cd14109" /db_xref="CDD:271011" misc_feature 21163..21429 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 21214..21228 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 21253..21267 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 21328..21342 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 21370..21387 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 21409..21420 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 21442..21729 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:238020" misc_feature order(21442..21444,21649..21651,21694..21696) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Interdomain contacts [active]" /db_xref="CDD:238020" misc_feature order(21697..21702,21706..21711) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Cytokine receptor motif [active]" /db_xref="CDD:238020" misc_feature 21922..22686 /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="Catalytic kinase domain, second repeat, of the Giant Serine/Threonine Kinase Uncoordinated protein 89; Region: STKc_Unc-89_rpt2; cd14112" /db_xref="CDD:271014" misc_feature order(21952..21966,21970..21972,21976..21978,22021..22023, 22027..22029,22099..22101,22147..22152,22156..22158, 22165..22167,22171..22173,22282..22284,22288..22290, 22294..22299,22303..22305,22339..22344,22351..22353, 22390..22401) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="active site" /db_xref="CDD:271014" misc_feature order(21952..21966,21970..21972,21976..21978,22021..22023, 22027..22029,22099..22101,22147..22152,22156..22158, 22165..22167,22294..22299,22303..22305,22339..22344) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:271014" misc_feature order(21964..21966,22165..22167,22171..22173,22282..22284, 22288..22290,22294..22296,22351..22353,22390..22401) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="polypeptide substrate binding site [polypeptide binding]; other site" /db_xref="CDD:271014" misc_feature order(22339..22377,22381..22401) /gene="unc-89" /locus_tag="CELE_C09D1.1" /note="activation loop (A-loop); other site" /db_xref="CDD:271014" ORIGIN
atggtgctcaagacgctctatattatcgagctaaccgataccgaggaaggaggtctcgagctcgtcgatccatcatggtgtccagaagaaggaggtccaccacgaaagaaggtaaaatcaccgccggtgatttcacctaccggctcgtccaccagtatctattcaggaggaagtagtagtattgattggacaacaactggaacgacactcgaaatgcaaggaacgcgtgtaaccagaacccaatacggtttcagaaccttgcaagaatcatcagcgaaaatgtgtctgaaagtaactggatatccattacctgatatcacatggtacaaagatgatgtacaacttcatgaagatgagagacacactttttattcggatgaagatggtttctttgcgatgaccattgatccagttcaggtgaccgacactggtcgttacacatgtatggcaacaaacgaatacggtcaggcatccacttctgcctttttccgagttttgaaagtcgaaaaagaagctgctccaccagcatttgtcacaaaactcagagacaaagaatgcaaagaaggtgatgttattgatttcgaatgtgaagttgaaggatggcctgaaccggaacttgtatggcttgtcgacgatcagccactccgaccatcccacgactttcggctgcaatatgatggacagacggcaaagctcgaaattcgtgatgctcagccggatgatactggagtctatacagtcaagattcaaaatgagttcggatcgattgaaagcaaggctgagctctttgttcaagcagatccagataagaaccatgtggctccagagttccaggcaacaattgaatatgttgagtgtgatgagggagaggaagttcgattcaagtcagttattactggagatcctaatccagaaatcatttggttcatcaatggaaaaccactgagtgaatcagaaaaagtcaagttcatctcggaagatggaatctgcatcttaacgattaaagacgtaaccaggcatttcgatggaatggttacatgtcaaggatcaaacagattgggttcagcgtcttgtgatggaaggctaaaagtcagagttccaccagcaccaccaacctttaataagccactcgaagataagacagtccaggagaagagtactgttgtgttcgaagtggatgtcagcggatggccagagccaacactaaccttcacactttgcggaaaagagttgaaaaacggtgaagaaggcgttgaaatcgtagggcacgacggtttctatcgcatttcgatcccgaacacatcgatggacaagcacgacggtgaaattgtggcaaaggctcaaaatgagcatggaaccgcggagagtagggcacggctcactgtggaacaggaggaggaggagtcgcgcagtgcgccgactttcttgaaggatattgaagatcaaaccgtaaaaaccggcgagttcgccgtcttcgagacaaccgttcgcggaaatccgaatccggaggttacttggttcatcaacgggcacaagatggatcagggcagtccgggcgtcaagatcgaggcgcacaatcacgaccataagctgactatcgactcggcacagtacgcgggcaccgtactctgcagagctgaaaatgctgttggacgattcgaaacgaaagcccgactcgttgttctggccccagaaaaacagaagaaaccaccgaaattcgtggagattcttgtcgacaaaaccgaaaccgtcgacaacacagttgtgtttgaagttcgcgttgaaggtgaaccaaaaccgactgtaacatggtatttaaaaggagaagaactcaaacaatcggatcgcgtcgagattcgagaattcgatggatcaataaaaatctcaatcaagaacatcaaaattgaagatgccggagagatcagggctgttgcgacaaactctgaaggatctgatgagacgaaggcgaaattgactgttcagaagaagccattcgctccagaatttgatttgcgaccagttagcttgacagtcgaaaagggatccgaagcagttttcagtgcacacgcttttggtattccattgccaacttatgaatggtctgtcaatggaagaaaggtgcgagatggacaggaaggggcgcgcgtaacacgtgacgagagcaccgtcgacggcgcatcgatcctgacgatcgacacggcgacatactattccgaagtgaaccatctgacaatttctgttgtcgcagaaaacacactcggagccgaagagacgggcgcccagttgacgatcgagccgaagaaggagagtgtcgtcgtcgaaaagcaagatttgtccagttcagaagtccagaaggaaatagctcagcaggtaaaagaagcttctcctgaggcaacaacaaccatcacaatggagacatcgttgacgtcaactaaaacaactacaatgtccacaactgaagtcacatcaacagttggaggagtgactgtcgagaccaaggagtcggaatcggaatccgcgacaacagtgatcggaggaggatcaggtggtgtaaccgagggaagcatcagtgttagcaagattgaggttgtctcgaagacggactcacagactgatgttagagaaggaacaccaaagagacgagtgtcgtttgctgaagaggaattgccaaaagaggttattgattcggaccgcaaaaagaagaagagtccaagcccggacaaaaaggagaagagccctgagaaaactgaggaaaagcctgctagtcctactaagaagactggtgaggaggtgaagtctccaaaggagaagagcccagcaagtccgacaaagaaggaaaagtcacctgcagcagaggaagttaaatcacctaccaaaaaggagaaatctccatcatcaccaaccaagaaggaaaagagcccatcgtctccaaccaaaaagactggggatgaggtgaaagaaaagtctccaccaaagagcccaaccaaaaaggaaaagagcccggagaaacctgaagatgtaaaatctccagttaagaaggaaaaaagcccggatgcaactaatattgttgaagtttcctctgaaacaacaattgagaaaactgaaactactatgaccactgagatgacacacgaatcggaagagtcaagaacttccgtgaaaaaggagaagactccggagaaggttgatgaaaaaccaaagagcccgacgaagaaggacaaatcaccagaaaagtctattaccgaggagatcaagtcacctgtcaaaaaagagaaatctccggagaaggtggaagagaaaccagctagtcctaccaagaaagagaagtctccagaaaaaccagcttcgccgacaaagaagtcggaaaatgaagtaaaatctccaactaaaaaagagaagagtccagagaaatctgtagttgaagagctaaaatctccaaaggaaaaatcaccagagaaggctgacgacaagccaaagagcccgacaaagaaggagaagtcacctgaaaaatcggctacggaagatgtgaaatctccaaccaaaaaagaaaaatctccagaaaaagttgaagagaagccaacgagcccaaccaaaaaagagtcctcgccaactaaaaagaccgatgatgaggtaaagtctccaaccaagaaggagaagagcccacaaaccgttgaagaaaaaccagctagcccgacaaagaaggagaagtcgccagagaaatctgtagtagaagaggtgaaatctcccaaagaaaaatctccagaaaaggctgaggagaagccaaagagtcctacaaagaaagagaagtcacctgaaaagtccgctgcggaagaagtcaaatctcctaccaaaaaagagaagtctccagaaaagtctgctgaggagaagcctaagagcccaaccaaaaaagagtcttcaccagttaaaatggcagatgatgaggtgaaatctccaaccaagaaggaaaagagccccgaaaaggttgaagaaaaacctgcgagcccaaccaagaaagaaaaaacaccagaaaagtcagctgccgaagaactcaaatctcccacgaagaaggaaaagagcccatcttcaccaaccaagaaaactggggacgaatccaaagaaaaatctccagaaaaaccagaggagaagccaaagagcccgacaccaaagaagtctccaccaggctcaccaaagaagaagaagtcaaagtcgccggaagccgaaaagcctccagcgccaaagctcactcgcgacctcaaattgcagacagtcaacaagaccgacttggcccatttcgaagttgtcgttgaacatgcaaccgagtgcaaatggttcttggatggaaaagagattacgacagcccaaggggttacggtttcaaaggacgatcaatttgaattccgttgctcaattgatacaaccatgtttggaagtggaactgtgtctgttgtggcttcaaatgctgctggttccgtggagactaagactgaattgaaggttttggaaactccaaaggaaaccaagaaaccagaattcactgacaagctcagagatatggaagtcacaaagggagatacagtacagatggacgtcatcgccctacactcgcctctatacaaatggtaccaaaatggaaatctgttggaagatggaaagaatggagttaccattaagaacgaggaaaacaaatcttcattgatcattccaaatgctcaagattctggaaagatcacagttgaagcttcgaacgaagtcggatcatctgaatcctctgctcaactgactgtcaatccaccatcaactaccccaattgttgttgatggaccaaagtcggtgactatcaaggaaacggaaactgctgagttcaaggcaacaattagcggattcccagcaccaactgtcaaatggacgattaatgaaaagatcgtagaggaatctagaactatcaccactatcaagacggaagacgtctatactttgaagatctctaatgcaaagatcgagcagactggaactgtgaaagttactgctcaaaattcagctggacaggatagcaagcaagctgaccttaaggttgaaccaaatgtgaaagctccaaagttcaagtctcagctcactgataaggttgctgatgaaggagaaccactccgttggaatcttgaattggatgggccatcacctggaactgaagtctcttggcttcttaacggacagccacttacaaagagtgatactgttcaagtagtcgatcatggagatggaacttatcatgtgacgattgcagaggccaagccagaaatgtctggaactcttacagcaaaagcaaagaacgccgcaggagagtgtgagacatcggcaaaggttactgtgaatggaggaaacaagaaaccagaatttgttcaagctccacaaaatcacgagacaactcttgaagaaagtgttaagttcagcgctattgttactggaaaaccaatgccaaatgtgacatggtatttgaacaacaagaagttgatccagagtgaggaggttaaagtgaagtatgttcatgagactggaaagacatcaatccgcattcaaaagccactcatggagcacaatggaactatccgcgttgaagctgagaatgtgtcaggaaaggttcaagccacagctcaattgaaggttgacaaaaagactgaagttccaaagttcactacgaacatggatgatcgtcaagtcaaagagggagaagatgtgaagttcactgcaaatgtggaaggataccctgaaccatctgtagcatggactttgaatggagaaccagtttctaagcatccaaacatcactgttaccgacaaggacggagagcacaccatcgaaatttccgccgtcacacccgaacaagctggagagctgtcttgcgaagcgacaaaccccgtcggatccaaaaagagagatgttcaactcgctgttaaaaaggtcggtgatgcaccaacgtttgcaaagaatctcgaagatcggttgatcaccgagggagagttgacattgatggatgctaaattaaacattgtaaaaccaaagccaaagatcacctggcttaaggatggtgttgaaattacttctgatgggcattataagattgttgaagaggaagatggatccttgaaacttagcattcttcaaactaaactggaagataagggaagaatcacgattaaagcggaaagcgaatttggcgttgcggaatgttcagcatctcttggagttgttaagggacgcccaatggccaaaccagcattccaaagtgatattgcaccaattaacctcaccgaaggagatacccttgaatgcaagcttctcatcaccggagacccaacacctttcgtcaagtggtacattggaacacaactcgtttgtgccactgaagatactgagatctctaatgccaatggagtttacactatgaagattcatggtgtgactgctgacatgactggaaagatcaagtgcgtcgcatacaataaggctggagaagtgagcaccgagggtccactcaaggttgttgcaccgattccggttgaatttgaaacatctctatgtgatgctacctgcagagaaggagatactctcaaattgagggcagtattgctcggagagccagaaccagttgtctcgtggtatgtgaacggaaagaagttggaagaatctcagaatatcaagattcattctgagaaaggaacatacacggttacaatcaaagacatcacatgcgattattctggacaagtcgtctgcgaggcaatcaacgagtatggaaaagcaacatctgaggctacattgctcgtgctgccacgtggtgaacctccagatttcttggaatggctcagcaatgttcgcgcaagaactggaaccaaggtcgtgcacaaggttgtcttcacaggagacccgaaaccaagccttacatggtacatcaataataaggagattctcaactcggatctttacaccatcgtcacagatgataaaacatcaacgttgacaatcaacagcttcaacccagatgttcatgttggagaaattatctgcaaggccgagaacgatgctggagaagtttcctgtaccgcaaacatgatcacctacacatctgacatgttcagtgaatctgaaagtgaagcccaagctgaagaatttgtcggagacgatctcactgaagatgagagtcttcgagaggaaatgcaccgtactccaactccagttatggcacccaaattcatcacaaagatcaaggataccaaagccaagaagggacactctgctgtctttgaatgcgttgttccagacaccaagggagtgtgctgcaagtggttgaaggacggaaaagagattgagctgattgccagaatccgggttcaaactagaactggaccagagggacacatcactcaagaacttgtcctcgacaacgtcactccagaagatgccggcaagtacacgtgcatcgttgagaacaccgccggaaaagatacctgtgaggcgacgctaactgtcattgaatcattggagaagaagtcggagaaaaaagctccagaattcattgttgctcttcaagataagacaacaaagacatccgagaaggttgttcttgaatgcaaagtcatcggagagccaaagccgaaagtcagctggcttcacgataataagacaattactcaagagtctatcacagttgaatcagtggaaggcgtcgaaagagtcacaatcacttcatctgaattgtctcatcaaggaaaatacacctgcattgccgagaacactgaaggaacatctaagactgaagcattcttgactgtccaaggcgaagctccagtgttcacaaaggaactgcagaacaaggagttatcaattggagagaagctcgttctctcgtgttctgtcaaaggatccccacagccgcatgtcgatttttattcgttctcggaaactacgaaggtggagacgaagatcacctcatccagtcgaatcgccattgagcatgaccagaccaatacgcattggagaatggttatcagtcaaatcacaaaagaagatattgtctcctacaaagctattgccacaaattcaattggaactgctacttcaacatcaaagatcaccacgaaggtagaggcaccagtctttgagcaaggattaaagaagacaagtgtgaaggagaaggaagaaattaagatggaagtaaaggtcggaggaagtgctccagatgttgaatggtttaaggatgacaaaccagtcagtgaagatggaaatcatgagatgaagaagaatccagaaactggagtgtttactctggttgtgaaacaagctgcaactacagatgctggaaagtataccgccaaggcttccaatccagcaggtactgctgaatcttctgcagaggctgaggtcactcaatctctcgagaaaccaactttcgtgagggaacttgtcacaactgaagtcaagatcaatgaaactgcaactttgtccgttacagtgaaaggagttccagatccgagtgttgaatggcttaaggatggacaaccagtgcaaactgattcaagtcatgtgattgctaaggttgaaggatccggaagctactcgattaccattaaggatgcgagactcgaggactctggaaagtacgcatgccgtgcaaccaatccagcaggtgaagccaaaactgaggctaactttgcagttgtcaagaacttggttccaccagaatttgttgagaaactcagtccactcgaagtgaaggagaaggaaagtaccaccttgtccgtcaaggttgtaggaacaccagaaccatctgttgaatggttcaaggatgatactccaattagtatcgacaatgttcatgtcattcagaagcagacagctgttggatccttcagtttaaccatcaatgacgcgagacagggagatgttggaatctactcttgccgtgctaggaatgaagctggggaagctcttacaacagcgaactttggaatcatcagggattctattccaccagagtttactcaaaaacttcgaccacttgaagtcagagagcaggagactcttgatttgaaagttactgtaattggaaccccagtaccaaatgttgaatggttcaaggatgataagccaatcaatattgataactcgcacatttttgcaaaggatgaaggatcaggacatcatactctcacaattaaacaagctagaggagaagatgttggagtctacacctgcaaagccaccaacgaagccggagaagccaaaaccactgcaaacatggctgttcaagaagagattgaagcaccattgtttgttcaaggcctgaaaccatacgaggtggaacaaggcaagccagctgaattggtggttcgtgtagaaggaaagccagagcctgaggttaaatggttcaaggatggagttccgattgctattgacaatcagcatgtgattgagaagaagggagagaatggatctcatactcttgtcatcaaagacaccaacaatgctgacttcggaaagtacacatgccaagctacaaacaaggctggaaaggatgaaactgttggagagctcaagattccaaagtattcattcgaaaagcaaactgctgaagaagtcaagccactgttcattgagccactaaaggaaacatttgccgttgaaggagataccgttgttcttgaatgcaaggtgaacaaggaatcacatccacaaatcaagttcttcaagaatgatcaaccagtggagattggacaacacatgcaattggaagtattggaagatggaaatatcaagctcacaattcaaaatgccaagaaagaagacgttggtgcatatcgttgcgaggctgtgaatgttgccggaaaggccaacacgaatgctgatttgaagattcaattcgctgctaaagttgaagaacatgtcaccgatgaaagtggccagcttgaggagattggacagtttgagactgtcggagatactgcatcctctaagaccgacactggacgtggagctccagaatttgtggagcttctccgttcgtgtacagttaccgagaagcaacaagcgatccttaagtgcaaggtgaaaggagagccacgaccaaagatcaagtggactaaggaaggaaaggaggtcgaaatgtcggcacgtgttcgcgctgagcacaaggatgatggaactttgacgctgacatttgataatgttactcaagccgacgccggagaatacagatgtgaggctgagaacgagtatggaagtgcatggaccgaagggccaattattgtcacattggaaggagctccaaagattgacggtgaagctccagacttcttgcaaccagtcaagccagctgttgttacagttggtgagactgcagttcttgaaggaaagatttctggaaaaccgaaaccaagtgttaaatggtacaagaatggagaagagctcaagccatccgatagagttaagattgagaatttggatgatggaactcaaagactcaccgttaccaacgctaaactcgacgatatggatgagtaccgctgtgaagcttcaaatgagtttggagatgtttggagtgacgtcactcttacagtcaaggaaccagctcaagttgctccaggattcttcaaggaactctctgctattcaggttaaggagactgaaaccgccaagtttgaatgcaaggtttcgggaactaagccagatgtgaaatggttcaaggacggaactccattgaaggaagacaaacgagtgcacttcgaatcaaccgacgatggaactcaaagacttgtcatcgaagattccaagactgatgatcaaggaaactaccgtattgaagtttccaatgatgctggagttgcgaacagcaaggttccactcacagtcgttccatcagaaaccctcaagatcaagaagggactcacagatgtaaatgttacacagggaaccaagatccttctctctgttgaagttgaaggaaaaccaaaaactgtcaaatggtacaagggaacagaaactgtcaccagctcccagaccacaaagatcgtgcaggtgaccgagtcagaatacaagttagaaatcgaaagcgctgagatgtctgatactggagcttaccgcgttgttctctctactgattcgttttctgttgagtcgtctgctacagtaactgtcaccaaggctgctgaaaagattagtcttccttcattcaagaagggactcgctgatcaatccgttccaaagggaactccattggttttggaagttgaaatcgaaggaaagccaaaagatgttaaatggtataagaatggagatgagatcaaggacgggaaggtcgaggatcttggaaacggaaaataccgactcacaattccagacttccaagagaaagatgttggagagtacagtgtcactgctgctaacgaggctggagaaattgaatcaaaggccaaggtaaacgtgagtgccaagcctgaaattgtttctgggctggtaccaactactgtgaagcaaggagaaactgccacctttaacgtcaaggtcaagggaccagtcaagggagtcaagtggtacaagaacggaaaagagattcctgatgctaaaacaaaggacaatggagatggatcctactctcttgagattccaaacgctcaagttgaagatgcagctgactataaggttgttgtctccaatgatgctggagatgctgattcttcagctgctcttaccgtcaaacttgctgacgatggaaaggataaggtgaaaccagaaattgtatcgggacttattccaactacagtgaagcaaggagaaactgccacctttaacgtcaaggtcaagggtccagtgaaacaggtcaagtggtataagaatggaaaagaaattcccaacgccaaggctaaggacaacggagatggatcctactctctggaaattccaaacgcgcaacttgatgacactgccgactacaaggttgttgtgtcgaatgatgctggagatgctgattcttcagctgctcttactgttaagcttcctggaatcgctattgttaagggacttgaagacgccgaagtgccaaagggcaagaaggctgttctccaagttgaaaccaacaagaagccaaaggaaattaaatggtataagaatggaaaggagattactccaagcgacaaggcacaacccggaagcgacggagacaacaaaccacagctggttattccagatgctggtgacgatgatgctgctgaatataaggttgtgttgactgatgaagatggaaatactgccgattcgtcatgcgccttgactgttaaattaccagcaaaagagccaaagatcatcaaaggactcgaggatcaagtggtgtcgattggatctccaattaagttggaaatcgaaacttctggatcaccgaagactgtgaaatggtacaaaaacggaaaggagcttccaggagctgccgccaagaccatcaagattcagaagatcgacgataacaagtatgttcttgagatcccatccagtgttgttgaagataccggagactacaaagtcgaagttgccaacgaggcaggatctgcaaacagcagtggaaagatcactgtggaaccaaagatcacgttcttaaagccactgaaggatcaatcgatcactgagggagaaaatgccgaattctcagttgaaaccaacaccaagccaagaattgtcaaatggtataagaatggacaagaaattaagccaaattcccgattcatcattgaacaaaagactgataccaagtatcaacttgttattaagaacgctgttcgtgatgatgcagacacctacaagattgttcttgaaaacaccgctggagaagccgaatcttctgctcaattgactgttaagaaagctaaggctggactctgcaagatcgtcaaaggtcttgaagaccaggttgttgccaagggtgccaagatggtatttgaggttaagatccaaggagagccagaggatgtcagatggcttcgtgatgcaaatgttatcagtgcaggagctaatgcaatcattgagaaaattgatgacaccacctacaggttgataattccatccgctgatttgaaggatgctggtgaatacactgtcgaagtaatcaatgagagtggaaaagccaagagtgatgcaaagggagaggttgatgagaaaccagagattgttcgaggacttgagaacatcgaaattccagagggagatgacgatgtgttcaaggttgaagtcagtgctccagtcagacaagtcaaatggtataaaaatgaccaggagatcaaaccaaacagccatttggaagccaaaaagatcggtccaaagaagtacgaacttgctatcaaccgtgctcaattggacgatggagccgactacaaggttgtgctatcgaatgctgcaggagattgtgattcttccgcggctctcactgttgtcaagccaaatgttctgaagattgtcgatggattgaaggatgttgatgttgaggaaccccaaccagttgaacttaaggtcaaggttgagggtattccaaaggttattaaatggtacaagaacggacaggagcttaagccagatgctgacggattcaaatttgaagagaaaccagaatctggagagttctctctcactatcccatcgtctaagaaatctgatgggggtgcataccgtgttgttcttggaaatgacaagggagaagtatacagtggatctgttgttcatgttaaatctgccaaatcatccgaaccaacatcaggagccaacttcctctccccactcaaggataccgaggttgaagaaggagatatgctcactcttcagtgcactattgctggagaaccattccccgaagtcatctgggagaaggatggtgttgtccttcagaaggatgatagaatcacgatgagagtcgcacttgatggtactgctaccctcagaattcgttctgccaagaagagtgacattggacaatatcgtgttactgcgaagaacgaagctggaagcgctacaagtgactgcaaggttaccgtcactgaacaaggagagcaaccatcgaagccaaagttcgttattccattgaagacgggagcagctcttccaggcgacaagaaggaattcaatgtgaaggttcgaggacttccaaagccaacattgcaatggttcttgaacggaatcccaatcaaattcgatgatagaatcaccctcgatgacatggctgatggaaactactgtcttacgattcgtgacgttcgtgaagaagacttcggaaccttgaagtgtattgcaaagaatgagaatggaacagatgaaactgtctgtgaattccaacaaggtgctggacacgatgatggatctagagacgatcttcgttatccaccaagattcaatgttccactttgggacagaagaatccctgttggtgacccaatgttcatcgagtgtcatgttgatgccaacccgaccgccgaagttgaatggttcaaggatggaaagaagatcgaacacactgcacataccgaaatcagaaacaccgttgatggagcatgtcgcatcaagatcattccattcgaggagtctgatattggagtttacatgtgcgttgctgtaaacgagttgggacaagctgaaactcaagccacataccaagttgagattttggaacatgtggaggaggagaagcgccgagaatatgctccaaagattaatccaccattggaagataaaactgtcaatggaggtcaaccaatcagattatcatgcaaggttgacgctatcccaagagcttcagtggtttggtacaaggatggacttccacttcgtgctgattctagaacctctattcaatatgaagaggatggtacagctacccttgcgatcaatgacagtaccgaggaagacattggagcataccgttgtgttgctacaaatgctcatggaacgatcaacaccagttgcagtgtgaacgtcaaggttccgaagcaggaagtcaagaaggagggagaagagccattcttcacaaagggacttgtcgatttgtgggcggatcgtggagattcgttcactttgaagtgcgcagtcaccggagatccattcccagaaatcaagtggtacagaaatggacaacttcttagaaatggaccaagaactgttattgaaacatcgccagatggttcatgttcacttactgtcaatgaatctacaatgagtgatgaaggaatctatcgatgtgaagctgaaaatgctcatggaaaggccaagactcaagctactgctcatgtgcaaatggctcttggaaagactgaaaaaccaaaaatggatgaaggaaaaccaccaaagttcattttggagctttctgatatgtcagtttctcttggaaatgttattgatttggaatgcaaggttaccggactaccaaatccatcagtcaaatggtcgaaggatggaggtccactgattgaggactccagattcgaatggtccaatgaagccagcaagggagtctatcagctcagaatcaagaacgccaccgtacatgacgagggaacttatcgctgcgttgccacaaatgagaatggaagtgctactaccaagtcatttgtaagaatggatgatggtcttggatcaggtgttgtgactgccagtcagccaccaagattcactttgaagatgggagatgttcgtacaactgaaggacaaccattaaaattggagtgtaaggttgacgctagcccacttccagagatggtttggtataaggatggagccattgttacaccatctgacagaattcaaattagtctgtcacctgatggagttgcaactcttcttatcccatcttgcgtctatgatgatgatggaatctaccgtgtaattgccaccaacccatctggaactgcccaggataagggaactgctactgttaagaaacttccaagagatagcggtgccagaaggtctgctgacagagatgtatttgatgctaacaaggcaccaaagcttatggagccactggagaatatcagaattcccgaaaagcagtcgttccgtcttcgttgcaagttcagcggagatccaaagccaacaatcaaatggttcaaggatggagaacgtgtattcccatacggacgtcttcaactcatcgagtctccagatggtgtctgtgagttggtggttgattctgccactcgtcaagatgctggaggatacagatgcgttgctgaaaacacttatggatctgctagaacatcttgcgatgttaatgttattcgcggtgatcgtaagccacgcgacattgactcgtccattcgtgaaggaaaggctccaggattcaccaccccattgacaatccgtcgtgctaagccaggagattccgtgacattcgaatgccttccattcggaaatccattcccatcaatcaagtggcttaaggatggacttgagctgttctctgatgaaaagatcaagatggaagctgctgcagatggaacccagcgactcattctttccgatgtcaccttcttgagtgaaggatacttcagatgtgtagctaccaatgagcatggaactgcttctacaaaggctgaacttgtcatcgaaggagaccgaactattggatcccgcccacttccagaagtaaacggagagcctgaagaatgcaagccaagaatccgtcgtggactgtacaacatgagtattcacgagggtaatgttgtggagatgatcgtctgtgcaactggtatcccaacgccaactgtcaagtggtacaaggatggacaggagattgtcggagatggacctgatggaaagagggtcatctttacggatgaacgaggaattcatcacttggttattgtgaatgcatctccagatgatgaaggagagtactcgttggaagcaacgaataagttgggatcagccaagaccgaaggatccttgaacattatcagaccaagacatattgcagatgctgacgagagaggaggcatgccattcccaccaggattcgtgcgtcaactaaagaacaagcacgtcttcaatcacatgccaacaatcttcgactgccttgttgtcggacacccagcccctgaagtagagtggttccacaatggaaagaagattgttccaggaggacgaatcaagattcaatcgtgtggaggaggatctcatgccctcatcattctcgatacaacccttgaagatgcaggagagtacgttgctactgcgaagaactctcatggatccgccagctcatcagcagtgcttgatgtgactgttccattcctggacagcatcaagttcaatggagagattgatgtgactccatacctcaccgaggaatatggattcaagaagcttaacaccgccagtctcccaactccaccagatcgtggaccattcatcaaggaggtcaccggacattatcttacactctcatggattccaacaaagagagctccaccacgttatccacaagtcacatatgttattgagattcgtgaacttccagagaaacaatggtctctcttggagtataacattccagagccagtatgcaaggttcgtaatttggaactcggaaagtcatatcaattccgtgttcgtgctgagaacatctatggaatctctgatccatcgccagcatctccaccatcaagactcatggctccaccacaaccagtattcgatagaagaacgaacaaagttattccacttcttgacccatatgcagaaaaagctcttgatatgagatactctgaacagtacgcgtgtgctccatggttctcaccaggagtcgttgagaagcgatactgcgccgagaacgataccctcacaattgttctgaatgtgtccggattcccggatccagatatcaaatggaagttccgtggatgggatattgacacgtcatcgccaacctctaaatgcaaagtgtacacttatggaggttccgagacaacattagccatcactggattcagcaaggagaatgttggacaatatcaatgtttcgccaagaacgattacggagatgcacaacaaaatattatggttgatcttgcaacacgaccaaacttcatccaaccactcgtgaacaagaccttctcatcagctcagccaatgagaatggacgtgagagtcgacggagaacctttcccagaattgaaatggatgaaggaatggcgcccaattgtcgagtcgtctcgcatcaagtttgttcaagacggaccttatttgtgctctttgatcattaatgatccaatgtggagagactccggaatctattcatgtgttgctgtaaatgatgccggacaagccacgacgtcgtgtactgttactgttgaagctgaaggcgactacaatgacgtcgaacttccccgtcgccgagtgacaatcgaatcgcgacgagtgcgagagctctacgaaatctctgaaaaagacgaaaagttggcggccgaaggagcaccatttcgagtcaaagaaaaagccacgggacgcgagtttttggcgcagttgagaccgatcgatgatgctctaatgcgccacgtggatatccacaattcgttggatcatccaggaattgtgcaaatgcatcgggtgcttagagatgagaaattggcattggtggtgtttgataatgcaaactcaactatcgacggcctctcaagccttgcgcaccctggcgtcgaaattgctgagccaaaaggagtcaaccgtgaaacatgtgttcgtgtctttgttcgtcaacttcttcttgctctcaagcacatgcatgatttgcgaattgcccatctagatctccgtcccgaaaccattcttcttcaagatgataagctgaaattagcagacttcggtcaagcaagacgccttctacgcggccttatcaccggagaaatcaagggatcgcccgagttcgtgagccctgaaatcgtgagaagttacccattgaccctggcaactgatatgtggagtactggagttttgacatatgtattactaaccggattgtcaccattccacggagataatgacaatgagacccttgcaaacgttgatagttgccaatttgattcgtctcctcttggcaacttctcctatgacgccggagatttcgtcaagaaactgttgaccgagattccagtctcacgtttgacagttgatgaagcattagaccatccatggattaacgatgaaaagctgaaaactgaacctttgtcagctgacacgttgagggaattcaaatatcagcataagtggctggaacgtcgcgtgttcgttcaacagacgccgtccgaacagattcttgaagcaattcttggtccggcaacggcacaagctcaacaaaatgctcctgtagcaccggaaggtcgacgtcctgctgaaatttacgactatctgagaattcagccgaaaaagccaccaccgactgtggaatacgttccacaacctagaaaagagcatccgccgtttattgacgaattcggacaacttattgacggagacgcttttgatcgaccagagggtactggatttgaaggaccacatagacaaccaccacaaattccacctcaacctcaacgaccgaaccaggcagctcacgattcgagacgacacgaacaacaaccacaacatcaggggcaaccacagcgaattcctgttgatcaatacggtcgtccgctagtcgacccacgttacctgaacgatccatcgcaccgcccgagttcccttgacgacgctccattctacgtggacaaatacggaaatccggtgcactttgacaaatacggtagaccaatggctccacaaaacttggaaaagcgaaagcttatcccacaagacaaaggagaaaccccatctcattccaaaaaagaaaagactcagcatccagttgctacaccgattctagcatcgccgggaggagatcaacagcagcagaagatcccgatgagaatgatccgtggggaacgaagagaaatcgaagaggaaattgcgaatagaatattatcagatatttctgaagaaggatcaattgctggttcacttgccagtttggaagattttgagattcccaaggatttccaagtagaggcatctgagccatcaacaccaactctcacaccagaagtaacaatcagagagactattccaaagccaacaccatctccaacatccccacagaaatctccagttccacaaccacaaggtctcttgattccagcaaaggtcacctactctgactcaatactcgccggactccctgcagcagataaaaaggtcctcgaagacgcggaaaacgatccatccatcccagtcggtgctccacttttccttgaaggactccacggatctgatcttacaatcgacacgacctcagcttcaggactgatcaaagtcacatccccagctatcaacctcagtccaaatccaaaatctccacgccgttccactccaggtacaaagagtccagttgtgttgagtccacgtcaagagcactcaatggaagtattgatcgcaacaaagcgaggaaaacctggattcttgccaccaggagaacttgctgaagatattgatgatgaggatgcatttatggatgacagaaagaaacaagtgaaaccaaaggatcatgatggagaaaatgatttcaaagatgagaaagaaagactggagaaggacaaaaacagaagaactgttaacttggatgatcttgataaatatcgtccaagtgcattctacaaagatgatagtgatttcggacatcctggatatgatattgatgcaactccatgggactcacattatcagattggtccagacacttatctgatggctgctcgtggagccgccttcaactcccgagtccgtaactatcgtgaggaactcttcggaatgggggctccaactgtcaaacagggattcctcggagtcagaaatcgtgacattactgttcgtgaacgtcgtcgttacactgatatcctccgcgagactacacaaggccttgagccaaaatctcatgagcaatcaacagctcttcttcaaaaagctccatcagcaacagcaattgagagaattaaggctgatattgagaaggtcacgccgtgtgccacaaagaagaatgatgatggaacctttgccccaatcttcactgcccgtctccgtgatgtgtatcttcgtaaaaaccaaccagcaattttcgaatgcgctgtttcagccagcccggctccaaaagttacttgggacttccaagggaagattctagagtctaacgacagggttacaatcgaacaagataacaatgtcgcccgtcttatccttaaccatgcagctccttacgatcttggagaatacgtgtgcactgccataaatgaatatggaacagataaatcaagttgccgactgataagtggagagactccatctcgtccaggaagacctgaagctgaactctcatctgatacggagattttcattcaatgggaagctccagaaggaccaacatatctggaaggtatcacctacagactcgaatatcgtgttgcaggaccgaatgatcatggtgacccatggatcactgtttctgaaaagattgatgatgaatctgtaattgttaaacatctatcaccacttggaatttatcaattccgagtcactgcacagaatggattcggtctagggctcccatcattgagtagcagaattgttcaaactcacggaaaaggagcaccaaagttgcaaattgatgttttgaaatccgagattcgactgaatgttgtttcaatgcctcaaaagtctacaaatcaattaggaggaatttcggaggaaagtgaagaggattcggaggcaagaacggcaaatgaagatatgaaatcaaatctgcaattgcaaactgatgatccaacaggacggttccagatcggtggtctcaagttcaagggacgtttctctgtgatccgcgacgccgtcgattccacaacagaaggtcacgcccattgcgctgtgaagattcgtcatccatcgtctgaagcgatctcagagtatgaatcgcttcgtgatggtcagcatgaaaatgttcaacgccttatcgccgcattcaataactccaatttcttgtatctattatcggaaagactctacgaagatgtgttttctcgttttgtgttcaacgattattatacagaagaacaagttgcattgacaatgagacaagtcacttcggcacttcatttcttgcatttcaaaggaattgcccatcttgatgtgaatccacacaacataatgttccaatcaaaacgtagttgggtcgtgaaactagttgattttggaagagcacaaaaagtgtcgggagctgtgaaaccagttgattttgatactaaatgggcttcaccagaattccatattccggaaactccggttaccgttcaaagtgacatgtggggtatgggagtcgtcactttctgccttctcgctggattccacccgttcacttctgaatacgaccgcgaagaggagatcaaggagaacgtgatcaatgtgaaatgtgatccaaatttgattccagtcaacgcttcccaagaatgcctttcatttgccacgtgggcgctcaaaaagtcgccagttcgccgaatgagaaccgacgaggctctttctcataagttcctttcttcagatccatcgatggttagaaggagggaatctattaaatactctgcatcaagactccgaaagcttgccgcaatgatccgccagccaacattcagccaaccaatcagcgaagagctcgagtcgaaatatggaaaataa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]