LOCUS       NM_001330894            1290 bp    mRNA    linear   INV 22-NOV-2023
DEFINITION  Caenorhabditis elegans Sex determination protein fox-1 (fox-1),
            partial mRNA.
ACCESSION   NM_001330894
VERSION     NM_001330894.3
DBLINK      BioProject: PRJNA158
KEYWORDS    RefSeq.
SOURCE      Caenorhabditis elegans
  ORGANISM  Caenorhabditis elegans
            Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida;
            Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae;
            Caenorhabditis.
REFERENCE   1  (bases 1 to 1290)
  AUTHORS   Sulson,J.E. and Waterston,R.
  CONSRTM   Caenorhabditis elegans Sequencing Consortium
  TITLE     Genome sequence of the nematode C. elegans: a platform for
            investigating biology
  JOURNAL   Science 282 (5396), 2012-2018 (1998)
   PUBMED   9851916
  REMARK    Erratum:[Science 1999 Jan 1;283(5398):35]
REFERENCE   2  (bases 1 to 1290)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (22-NOV-2023) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 1290)
  AUTHORS   WormBase.
  CONSRTM   WormBase Consortium
  TITLE     Direct Submission
  JOURNAL   Submitted (29-OCT-2023) WormBase Group, European Bioinformatics
            Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org
REFERENCE   4  (bases 1 to 1290)
  AUTHORS   Sulson,J.E. and Waterston,R.
  TITLE     Direct Submission
  JOURNAL   Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger
            Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute
            at Washington University, St. Louis, MO 63110, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by WormBase. This
            record is derived from an annotated genomic sequence (NC_003284).
            
            On Apr 15, 2020 this sequence version replaced NM_001330894.2.
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..1290
                     /organism="Caenorhabditis elegans"
                     /mol_type="mRNA"
                     /strain="Bristol N2"
                     /db_xref="taxon:6239"
                     /chromosome="X"
     gene            <1..>1290
                     /gene="fox-1"
                     /locus_tag="CELE_T07D1.4"
                     /db_xref="GeneID:180549"
                     /db_xref="WormBase:WBGene00001484"
     CDS             1..1290
                     /gene="fox-1"
                     /locus_tag="CELE_T07D1.4"
                     /standard_name="T07D1.4d"
                     /note="Confirmed by transcript evidence"
                     /codon_start=1
                     /product="Sex determination protein fox-1"
                     /protein_id="NP_001317857.1"
                     /db_xref="GeneID:180549"
                     /db_xref="GOA:A0A168HBS9"
                     /db_xref="InterPro:IPR000504"
                     /db_xref="InterPro:IPR012677"
                     /db_xref="InterPro:IPR034237"
                     /db_xref="InterPro:IPR035979"
                     /db_xref="UniProtKB/TrEMBL:A0A168HBS9"
                     /db_xref="WormBase:WBGene00001484"
                     /translation="

MAELIEEVSTATHASLNACDPIVVNSEALPMQALYQLSATGAQQQNQQIPIGLSNSLLYQQLAAHQQIAAQQHQQQLAVSAAHQTQNNIMLATSAPSLINHMENSTDGKVKDDPNSDYDLQLSIQQQLAAAAQAAQMGQTQIGPQIVGQQGQPVVATTAGSTNGSAAVTQPDPSTSSGPDGPKRLHVSNIPFRFRDPDLKTMFEKFGVVSDVEIIFNERGSKGFGFVTMERPQDAERARQELHGSMIEGRKIEVNCATARVHSKKVKPTGGILDQMNPLMAQSALAAQAQMNRALLLRSPLVAQSLLGRGAALIPGMQQPAFQLQAALAGNPLAQLQGQPLLFNAAALQTNALQQSAFGMDPAAVQAALLANEQARFQLAAAAAQGRIPSSGNASAFGEQYLSNALATASLPSYQMNPALRTLNRFTPY"

     misc_feature    547..774
                     /gene="fox-1"
                     /locus_tag="CELE_T07D1.4"
                     /note="RNA recognition motif (RRM) found in vertebrate RNA
                     binding protein fox-1 homologs and similar proteins;
                     Region: RRM_FOX1_like; cd12407"
                     /db_xref="CDD:409841"
     misc_feature    order(550..552,556..558,562..579,637..651,655..672,
                     676..678,748..750,763..774)
                     /gene="fox-1"
                     /locus_tag="CELE_T07D1.4"
                     /note="RNA binding site [nucleotide binding]; other site"
                     /db_xref="CDD:409841"
     misc_feature    <553..1251
                     /gene="fox-1"
                     /locus_tag="CELE_T07D1.4"
                     /note="polyadenylate binding protein, human types 1, 2, 3,
                     4 family; Region: PABP-1234; TIGR01628"
                     /db_xref="CDD:130689"
ORIGIN      

atggctgaactaatcgaagaggtgagcactgctactcacgcttctctcaatgcatgtgacccgattgtagtgaattctgaggctctgcccatgcaagccctgtaccaactgtctgccacaggggctcaacaacagaatcaacaaattccgattggattgagcaactcattgctctatcagcaattggcggcacatcagcaaattgctgctcaacagcatcagcaacagctcgctgtctctgcagctcatcaaacacaaaacaatataatgcttgctaccagcgctccatcattgattaatcatatggagaactcgacggacggtaaagtcaaggacgatccgaacagtgattacgatttgcaactctcgattcagcaacaattggcggcggcagcgcaagctgctcagatgggacaaacgcagattggtccacaaattgtgggacaacaagggcagccggtagtcgccacaacggccggttcgacgaatggctcggcggccgtcacacagcccgatcccagcactagctccggacccgatggaccaaaaagacttcacgtatcgaatatcccattcagattcagagacccagacctcaaaacgatgtttgagaaatttggtgtggtttccgacgtagaaattattttcaatgagcgaggatcaaaggggtttggatttgtgacaatggagagaccgcaggatgctgagagagctagacaagagcttcatggatcaatgattgaaggacggaaaattgaagtcaactgcgctacagctcgtgttcactcgaagaaagttaaaccaactggaggaatcctggaccaaatgaacccactgatggcccaatcagctcttgccgcacaggctcagatgaacagagccctattgctccgtagtccattggtagcacaatctcttcttggtcgcggagccgctttaatccccggaatgcaacagcccgcgttccaattgcaagcggctttggctggcaatccgctggcacaacttcaaggtcaacctttgctgttcaacgctgcagcccttcaaacgaacgcactccaacagtcggcgtttggaatggatccggccgccgttcaagctgctctgcttgccaatgagcaagctcggtttcaactcgctgctgccgctgctcaaggacggatcccatcatctggaaatgcctcggcgtttggcgaacaataccttagcaacgcgttggccaccgcctcactcccctcatatcaaatgaacccggcgcttagaacgttaaatcgatttactccgtattga

//