LOCUS       NM_001047474            2604 bp    mRNA    linear   INV 22-NOV-2023
DEFINITION  Caenorhabditis elegans Piwi domain-containing protein (csr-1),
            partial mRNA.
ACCESSION   NM_001047474
VERSION     NM_001047474.3
DBLINK      BioProject: PRJNA158
KEYWORDS    RefSeq.
SOURCE      Caenorhabditis elegans
  ORGANISM  Caenorhabditis elegans
            Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida;
            Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae;
            Caenorhabditis.
REFERENCE   1  (bases 1 to 2604)
  AUTHORS   Sulson,J.E. and Waterston,R.
  CONSRTM   Caenorhabditis elegans Sequencing Consortium
  TITLE     Genome sequence of the nematode C. elegans: a platform for
            investigating biology
  JOURNAL   Science 282 (5396), 2012-2018 (1998)
   PUBMED   9851916
  REMARK    Erratum:[Science 1999 Jan 1;283(5398):35]
REFERENCE   2  (bases 1 to 2604)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (22-NOV-2023) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 2604)
  AUTHORS   WormBase.
  CONSRTM   WormBase Consortium
  TITLE     Direct Submission
  JOURNAL   Submitted (29-OCT-2023) WormBase Group, European Bioinformatics
            Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org
REFERENCE   4  (bases 1 to 2604)
  AUTHORS   Sulson,J.E. and Waterston,R.
  TITLE     Direct Submission
  JOURNAL   Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger
            Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute
            at Washington University, St. Louis, MO 63110, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by WormBase. This
            record is derived from an annotated genomic sequence (NC_003282).
            
            On Apr 15, 2020 this sequence version replaced NM_001047474.2.
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..2604
                     /organism="Caenorhabditis elegans"
                     /mol_type="mRNA"
                     /strain="Bristol N2"
                     /db_xref="taxon:6239"
                     /chromosome="IV"
     gene            <1..>2604
                     /gene="csr-1"
                     /locus_tag="CELE_F20D12.1"
                     /db_xref="GeneID:177591"
                     /db_xref="WormBase:WBGene00017641"
     CDS             1..2604
                     /gene="csr-1"
                     /locus_tag="CELE_F20D12.1"
                     /standard_name="F20D12.1b"
                     /note="Confirmed by transcript evidence"
                     /codon_start=1
                     /product="Piwi domain-containing protein"
                     /protein_id="NP_001040939.1"
                     /db_xref="EnsemblGenomes-Gn:WBGene00017641"
                     /db_xref="EnsemblGenomes-Tr:F20D12.1b"
                     /db_xref="GeneID:177591"
                     /db_xref="GOA:Q27GU1"
                     /db_xref="InterPro:IPR003100"
                     /db_xref="InterPro:IPR003165"
                     /db_xref="InterPro:IPR012337"
                     /db_xref="InterPro:IPR036085"
                     /db_xref="InterPro:IPR036397"
                     /db_xref="UniProtKB/TrEMBL:Q27GU1"
                     /db_xref="WormBase:WBGene00017641"
                     /translation="

MNQKQNPRLALNIFGLELSERTIFRHVVQMKLIDRQHNKEYILTTMSARGRGNRATKQKDNFILLDILLKQWAAKKGQQNLPAFAYDGAQSLFTLEGISLMVDIKKEDALEIPELSNFLKDSISFLSGDLEISCEPDLEKPSFVQTELNEWSDPRFYAYLDIVTSQSAIRSERYLSQSKGLYVHTQSLEELRVKWAVAAKGIHKGCRIVGANGPLPILELDPQSTQYYASIPLSQMLQYAFPRDFPPNRIVNPNMKLQRAVKLLLKDLKCNPYYDDKQIWATNTITVSDVDYNAPKDPEFRQKYPNLKFPMLPAVQCGTGPHKRLMPLEYLKVLPYQSIDRRVLEEFELTPRANAPNERWSTLQKHYDQFGFNDQVMKDFGVQICNDPFNNVSEIDGERVLAPSVAYADPVHVDDEKRDWKAQDKKFVTPATIDHLMFVLVAGYTRTWDADCDATKFVAKAFMQRCKDKGMHIGSYSMDQHNGERGSENFLTSVFKNLVTHPNYRDSSFTPFVLFISDDVPNIHECLKFEERMSDIPTQHVLLKNVKKMRDNIEKKSQGGRRAYDLTLDNIVMKANIKCGGLNYTADIPRDLACWNEVSTFVIGMDVAHPDRNAAREGNPSTVGLSCNSAENPYSFIGDFLYTDPRREAIQDEILRKFTDQSVRNFAEIRGFPKKVIIFRDGVSFGEETAALKEVEIIEQTIKTAAKSMGHSDYAPKVLAIVVKKRHHTRFYAKGGHHGNMPINPLPDTSVGGDIAEYGKRQIFIQAFRPVQGTAKVPSFLVIRDDEEVSDEHVAKMVCAVCSLHQLVNSPTSIPTPVYVAHELAKRGTGLYKAYRFKNGELFDDWETLTTQLSYSTLDRLSKVRVV"

     misc_feature    592..1002
                     /gene="csr-1"
                     /locus_tag="CELE_F20D12.1"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(802..804,847..849,865..867,898..900,949..951,
                     970..972,976..978)
                     /gene="csr-1"
                     /locus_tag="CELE_F20D12.1"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1174..2490
                     /gene="csr-1"
                     /locus_tag="CELE_F20D12.1"
                     /note="PIWI domain. Domain found in proteins involved in
                     RNA silencing. RNA silencing refers to a group of related
                     gene-silencing mechanisms mediated by short RNA molecules,
                     including siRNAs, miRNAs, and heterochromatin-related
                     guide RNAs. The central component...; Region: Piwi-like;
                     cd02826"
                     /db_xref="CDD:239208"
     misc_feature    order(1570..1572,1582..1584,1615..1626,1633..1635,
                     1699..1701,1708..1710,1720..1722,1732..1734)
                     /gene="csr-1"
                     /locus_tag="CELE_F20D12.1"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:239208"
     misc_feature    order(1816..1818,1822..1824,2041..2043,2464..2466)
                     /gene="csr-1"
                     /locus_tag="CELE_F20D12.1"
                     /note="active site"
                     /db_xref="CDD:239208"
ORIGIN      

atgaatcagaagcaaaatccaagacttgccctgaacatcttcgggcttgagctctctgagcgaacgattttccggcatgttgtgcaaatgaagctcatcgatcgtcagcacaataaggagtatattcttacaacaatgagtgccagaggacgtggaaaccgtgcaacaaagcaaaaagataactttattcttcttgacatcctactcaaacagtgggccgcgaagaagggtcagcagaatcttcctgcattcgcgtacgacggtgcacagtctttattcactttggagggaatcagcttgatggtcgatatcaagaaagaagatgctctcgaaatcccggaactttccaattttctgaaggattccatctcgttcctcagcggcgatttggagatctcttgtgaaccggatctcgagaaaccgtcattcgttcagacggagcttaacgaatggagtgatccaagattctacgcttatttggatattgtgacatcacagagtgccattagaagcgaaagatatttgtcgcagtcgaaaggtctctatgtccacactcaaagcttggaggagcttcgcgtgaaatgggctgttgcagcaaaaggaatccacaaaggatgccgaatcgtcggagcaaacggacctcttccaattctagaactcgatcctcaatcgactcagtactatgcttcaatcccactcagtcagatgttgcagtacgcatttcctcgtgattttccgccaaaccgtatcgttaatccaaatatgaaactgcaaagagccgtgaaactattgttgaaggatttaaaatgcaacccatattacgatgacaaacagatttgggctacgaacactatcacagtgtcggatgttgactacaacgcgccgaaagatccagaattcagacaaaagtatccaaatctgaaattcccaatgcttcctgcagttcaatgcggcactggaccacacaagcgcctcatgccgctcgaatatttgaaggttcttccttatcaatccattgaccgccgtgtactcgaagagtttgagcttacaccacgagcgaatgccccgaacgaacgctggtcaactcttcaaaaacactacgatcaatttggtttcaacgatcaagtcatgaaagattttggtgtccaaatctgcaatgatcctttcaacaacgtcagtgagatcgacggtgaaagagtcctcgcgcctagtgttgcatatgcagacccggtacacgtggatgatgagaagcgtgactggaaagcacaagacaaaaagtttgttacacctgctacgattgaccatttgatgttcgttctagtagcaggttatactcgaacttgggatgctgattgcgatgcaaccaaatttgtcgcgaaagcattcatgcagcgttgcaaggacaaaggaatgcacattggcagttatagcatggatcagcacaatggcgaacgaggcagcgaaaatttccttacttcggtcttcaaaaacttggtgactcatccaaactaccgggattcgtctttcactccgttcgtcttgtttatttccgatgacgttcctaacattcatgagtgcctcaaattcgaagagcgtatgagtgacattccaacgcagcacgtacttctcaaaaatgtcaaaaagatgcgtgacaacatcgaaaagaagtctcaaggtggaagaagagcatatgatttgactcttgacaatattgtgatgaaagccaacattaaatgcggtggacttaactacacagcagatattccaagagatcttgcgtgctggaatgaagtttctaccttcgtaattggaatggacgttgctcatcctgaccgaaacgctgcgagagaaggaaatccatccaccgtcggactgtcctgcaattctgctgaaaacccatactcgttcattggagacttcttatacaccgatcctagaagagaggcgatccaggatgaaattttgcgaaaattcactgaccaaagcgttcgaaactttgccgaaattcgaggtttcccaaagaaagtaatcatcttccgtgatggtgtttcattcggtgaagagactgcggctctgaaggaggtggaaatcattgagcaaaccattaagacagccgctaagtccatgggccattctgattatgctccaaaagtattagccattgttgttaaaaaacgtcaccacactcgattctacgccaagggaggacatcacgggaacatgccgatcaatccgcttcccgatacatctgttggtggtgatattgccgaatatggaaaaagacaaatcttcatccaagctttccggccagtgcaaggtactgcaaaggttccatcattcttggttattcgagatgatgaggaagtttcggacgaacatgttgccaaaatggtttgcgccgtatgcagtcttcatcagcttgttaacagtccaacatccatcccaactccagtttacgttgctcatgagctcgccaagagaggaaccgggctttacaaagcttataggttcaagaatggcgaactctttgatgattgggaaacgctcaccactcaactctcctatagcactctcgatcgactttcaaaagttcgagttgtttag

//