2024-05-17 17:29:28, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_116532 1055 bp mRNA linear PLN 20-OCT-2022 DEFINITION Arabidopsis thaliana endoplasmic reticulum auxin binding protein 1 (ABP1), mRNA. ACCESSION NM_116532 VERSION NM_116532.3 DBLINK BioProject: PRJNA116 BioSample: SAMN03081427 KEYWORDS RefSeq. SOURCE Arabidopsis thaliana (thale cress) ORGANISM Arabidopsis thaliana Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Camelineae; Arabidopsis. REFERENCE 1 (bases 1 to 1055) AUTHORS Mayer,K., Schuller,C., Wambutt,R., Murphy,G., Volckaert,G., Pohl,T., Dusterhoft,A., Stiekema,W., Entian,K.D., Terryn,N., Harris,B., Ansorge,W., Brandt,P., Grivell,L., Rieger,M., Weichselgartner,M., de Simone,V., Obermaier,B., Mache,R., Muller,M., Kreis,M., Delseny,M., Puigdomenech,P., Watson,M., Schmidtheini,T., Reichert,B., Portatelle,D., Perez-Alonso,M., Boutry,M., Bancroft,I., Vos,P., Hoheisel,J., Zimmermann,W., Wedler,H., Ridley,P., Langham,S.A., McCullagh,B., Bilham,L., Robben,J., Van der Schueren,J., Grymonprez,B., Chuang,Y.J., Vandenbussche,F., Braeken,M., Weltjens,I., Voet,M., Bastiaens,I., Aert,R., Defoor,E., Weitzenegger,T., Bothe,G., Ramsperger,U., Hilbert,H., Braun,M., Holzer,E., Brandt,A., Peters,S., van Staveren,M., Dirske,W., Mooijman,P., Klein Lankhorst,R., Rose,M., Hauf,J., Kotter,P., Berneiser,S., Hempel,S., Feldpausch,M., Lamberth,S., Van den Daele,H., De Keyser,A., Buysshaert,C., Gielen,J., Villarroel,R., De Clercq,R., Van Montagu,M., Rogers,J., Cronin,A., Quail,M., Bray-Allen,S., Clark,L., Doggett,J., Hall,S., Kay,M., Lennard,N., McLay,K., Mayes,R., Pettett,A., Rajandream,M.A., Lyne,M., Benes,V., Rechmann,S., Borkova,D., Blocker,H., Scharfe,M., Grimm,M., Lohnert,T.H., Dose,S., de Haan,M., Maarse,A., Schafer,M., Muller-Auer,S., Gabel,C., Fuchs,M., Fartmann,B., Granderath,K., Dauner,D., Herzl,A., Neumann,S., Argiriou,A., Vitale,D., Liguori,R., Piravandi,E., Massenet,O., Quigley,F., Clabauld,G., Mundlein,A., Felber,R., Schnabl,S., Hiller,R., Schmidt,W., Lecharny,A., Aubourg,S., Chefdor,F., Cooke,R., Berger,C., Montfort,A., Casacuberta,E., Gibbons,T., Weber,N., Vandenbol,M., Bargues,M., Terol,J., Torres,A., Perez-Perez,A., Purnelle,B., Bent,E., Johnson,S., Tacon,D., Jesse,T., Heijnen,L., Schwarz,S., Scholler,P., Heber,S., Francs,P., Bielke,C., Frishman,D., Haase,D., Lemcke,K., Mewes,H.W., Stocker,S., Zaccaria,P., Bevan,M., Wilson,R.K., de la Bastide,M., Habermann,K., Parnell,L., Dedhia,N., Gnoj,L., Schutz,K., Huang,E., Spiegel,L., Sehkon,M., Murray,J., Sheet,P., Cordes,M., Abu-Threideh,J., Stoneking,T., Kalicki,J., Graves,T., Harmon,G., Edwards,J., Latreille,P., Courtney,L., Cloud,J., Abbott,A., Scott,K., Johnson,D., Minx,P., Bentley,D., Fulton,B., Miller,N., Greco,T., Kemp,K., Kramer,J., Fulton,L., Mardis,E., Dante,M., Pepin,K., Hillier,L., Nelson,J., Spieth,J., Ryan,E., Andrews,S., Geisel,C., Layman,D., Du,H., Ali,J., Berghoff,A., Jones,K., Drone,K., Cotton,M., Joshu,C., Antonoiu,B., Zidanic,M., Strong,C., Sun,H., Lamar,B., Yordan,C., Ma,P., Zhong,J., Preston,R., Vil,D., Shekher,M., Matero,A., Shah,R., Swaby,I.K., O'Shaughnessy,A., Rodriguez,M., Hoffmann,J., Till,S., Granat,S., Shohdy,N., Hasegawa,A., Hameed,A., Lodhi,M., Johnson,A., Chen,E., Marra,M., Martienssen,R. and McCombie,W.R. TITLE Sequence and analysis of chromosome 4 of the plant Arabidopsis thaliana JOURNAL Nature 402 (6763), 769-777 (1999) PUBMED 10617198 REFERENCE 2 (bases 1 to 1055) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (19-OCT-2022) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 1055) AUTHORS Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M., Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R., Vaughn,M. and Town,C.D. TITLE Direct Submission JOURNAL Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute, 9704 Medical Center Dr, Rockville, MD 20850, USA REMARK Protein update by submitter REFERENCE 4 (bases 1 to 1055) AUTHORS Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E. CONSRTM TAIR TITLE Direct Submission JOURNAL Submitted (18-FEB-2011) Department of Plant Biology, Carnegie Institution, 260 Panama Street, Stanford, CA, USA COMMENT REVIEWED REFSEQ: This record has been curated by TAIR and Araport. This record is derived from an annotated genomic sequence (NC_003075). On Sep 12, 2016 this sequence version replaced NM_116532.2. FEATURES Location/Qualifiers source 1..1055 /organism="Arabidopsis thaliana" /mol_type="mRNA" /db_xref="taxon:3702" /chromosome="4" /ecotype="Columbia" gene 1..1055 /gene="ABP1" /locus_tag="AT4G02980" /gene_synonym="ABP; AT-ERABP1; endoplasmic reticulum auxin binding protein 1; T4I9.14; T4I9_14" /note="Auxin binding protein involved in cell elongation and cell division. ABP1 is ubiquitinated in vitro and in planta by AtRma2." /db_xref="Araport:AT4G02980" /db_xref="GeneID:828120" /db_xref="TAIR:AT4G02980" CDS 160..756 /gene="ABP1" /locus_tag="AT4G02980" /gene_synonym="ABP; AT-ERABP1; endoplasmic reticulum auxin binding protein 1; T4I9.14; T4I9_14" /inference="Similar to RNA sequence, EST:INSD:EL132735.1,INSD:ES058604.1,INSD:DR237539.1, INSD:DR237540.1,INSD:DR237534.1,INSD:DR237532.1, INSD:DR377148.1,INSD:AI999148.1,INSD:AV822080.1, INSD:ES198127.1,INSD:DR202912.1,INSD:DR237529.1, INSD:DR237526.1,INSD:DR375275.1,INSD:ES058936.1, INSD:BP656634.1,INSD:DR237537.1,INSD:EL140402.1, INSD:DR378703.1,INSD:DR237527.1,INSD:DR237531.1, INSD:AV782715.1,INSD:BP814675.1,INSD:EH936821.1, INSD:EL038128.1,INSD:BP600783.1,INSD:DR237538.1, INSD:BP815740.1,INSD:DR202913.1,INSD:DR202909.1, INSD:EH898980.1,INSD:EL000984.1,INSD:EL185126.1" /inference="Similar to RNA sequence, mRNA:INSD:AY087315.1,INSD:AY093754.1,INSD:AF389278.1, INSD:S40550.1" /note="endoplasmic reticulum auxin binding protein 1 (ABP1); FUNCTIONS IN: auxin binding; INVOLVED IN: positive regulation of cell division, positive regulation of cell size, unidimensional cell growth, positive regulation of DNA endoreduplication, cytokinesis; LOCATED IN: endomembrane system, endoplasmic reticulum lumen; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin-binding protein (InterPro:IPR000526), Cupin, RmlC-type (InterPro:IPR011051), RmlC-like jelly roll fold (InterPro:IPR014710); Has 186 Blast hits to 186 proteins in 64 species: Archae - 10; Bacteria - 50; Metazoa - 0; Fungi - 0; Plants - 107; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink)." /codon_start=1 /product="endoplasmic reticulum auxin binding protein 1" /protein_id="NP_192207.1" /db_xref="GeneID:828120" /db_xref="TAIR:AT4G02980" /db_xref="Araport:AT4G02980" /translation="
MIVLSVGSASSSPIVVVFSVALLLFYFSETSLGAPCPINGLPIVRNISDLPQDNYGRPGLSHMTVAGSVLHGMKEVEIWLQTFAPGSETPIHRHSCEEVFVVLKGSGTLYLAETHGNFPGKPIEFPIFANSTIHIPINDAHQVKNTGHEDLQVLVIISRPPIKIFIYEDWFMPHTAARLKFPYYWDEQCIQESQKDEL"
misc_feature 265..753 /gene="ABP1" /locus_tag="AT4G02980" /gene_synonym="ABP; AT-ERABP1; endoplasmic reticulum auxin binding protein 1; T4I9.14; T4I9_14" /note="Auxin binding protein; Region: Auxin_BP; pfam02041" /db_xref="CDD:396569" misc_feature order(286..300,352..354,376..387,391..393,448..450, 454..456,460..462,484..486,490..492,532..534,538..543, 547..561,619..621,625..627,631..636) /gene="ABP1" /locus_tag="AT4G02980" /gene_synonym="ABP; AT-ERABP1; endoplasmic reticulum auxin binding protein 1; T4I9.14; T4I9_14" /note="homodimer interface [polypeptide binding]; other site" /db_xref="CDD:380349" misc_feature order(337..339,394..396,400..402,424..429,433..435, 439..441,451..453,457..459,580..582,712..714) /gene="ABP1" /locus_tag="AT4G02980" /gene_synonym="ABP; AT-ERABP1; endoplasmic reticulum auxin binding protein 1; T4I9.14; T4I9_14" /note="active site" /db_xref="CDD:380349" ORIGIN
tcgaaaatgaaaaatagtattttctgactcttttttatagtatcgggtttaattcagaaatatataaagctttggggtctgtttcgaagtatctttactcttttaacagttctgagacttctaaagagaggaaaattagttcgtcgaagcatcgagaaaatgatcgtactttctgttggttccgcttcttcatctccgatcgtcgtcgtcttttccgtcgcgcttcttctgttctacttctctgaaacttctctaggagctccttgtcccatcaatggcttgccaatcgtgaggaatattagtgaccttcctcaggataactatggaagaccaggtctttcccacatgactgttgctggctccgtattgcatggaatgaaagaggttgaaatatggcttcagacatttgctccaggttcagagacaccaattcacaggcactcctgtgaagaggtttttgttgtcctaaagggcagtggtactctgtatctcgctgaaacacatggaaatttccctgggaaaccaatcgaatttccaatctttgccaacagtacaattcatattccgatcaatgatgctcatcaggtcaaaaacaccggtcatgaggacctgcaggtgttggttatcatatctcggccgcctattaaaatcttcatctacgaagactggtttatgccacacactgctgcaaggctgaagttcccttactattgggatgagcaatgcattcaagaatcacaaaaagacgagctttaaagcaaagtccgaggctaaaagcaagcacaacctttagatagtaaaatcatagttgaggttttgtgacactacgtagatactggtaaattggcaaggattttacatgaatgttgttgttaccagaaagtaaataaatgttcaatctttgatgttcttaagtaagtgagtcctattggtcatgaaaatatgtaagtgtgcacatcttgattgcatttgcgataaatttatagagtttcactcacttttattttcctcttctatattcaaatcatagctcttcgaagacaagaggacatcag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]