LOCUS       NM_123317               2259 bp    mRNA    linear   PLN 20-OCT-2022
DEFINITION  Arabidopsis thaliana Zinc finger (C3HC4-type RING finger) family
            protein (VIM3), mRNA.
ACCESSION   NM_123317
VERSION     NM_123317.4
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 2259)
  AUTHORS   Tabata,S., Kaneko,T., Nakamura,Y., Kotani,H., Kato,T., Asamizu,E.,
            Miyajima,N., Sasamoto,S., Kimura,T., Hosouchi,T., Kawashima,K.,
            Kohara,M., Matsumoto,M., Matsuno,A., Muraki,A., Nakayama,S.,
            Nakazaki,N., Naruo,K., Okumura,S., Shinpo,S., Takeuchi,C., Wada,T.,
            Watanabe,A., Yamada,M., Yasuda,M., Sato,S., de la Bastide,M.,
            Huang,E., Spiegel,L., Gnoj,L., O'Shaughnessy,A., Preston,R.,
            Habermann,K., Murray,J., Johnson,D., Rohlfing,T., Nelson,J.,
            Stoneking,T., Pepin,K., Spieth,J., Sekhon,M., Armstrong,J.,
            Becker,M., Belter,E., Cordum,H., Cordes,M., Courtney,L.,
            Courtney,W., Dante,M., Du,H., Edwards,J., Fryman,J., Haakensen,B.,
            Lamar,E., Latreille,P., Leonard,S., Meyer,R., Mulvaney,E.,
            Ozersky,P., Riley,A., Strowmatt,C., Wagner-McPherson,C., Wollam,A.,
            Yoakum,M., Bell,M., Dedhia,N., Parnell,L., Shah,R., Rodriguez,M.,
            See,L.H., Vil,D., Baker,J., Kirchoff,K., Toth,K., King,L.,
            Bahret,A., Miller,B., Marra,M., Martienssen,R., McCombie,W.R.,
            Wilson,R.K., Murphy,G., Bancroft,I., Volckaert,G., Wambutt,R.,
            Dusterhoft,A., Stiekema,W., Pohl,T., Entian,K.D., Terryn,N.,
            Hartley,N., Bent,E., Johnson,S., Langham,S.A., McCullagh,B.,
            Robben,J., Grymonprez,B., Zimmermann,W., Ramsperger,U., Wedler,H.,
            Balke,K., Wedler,E., Peters,S., van Staveren,M., Dirkse,W.,
            Mooijman,P., Lankhorst,R.K., Weitzenegger,T., Bothe,G., Rose,M.,
            Hauf,J., Berneiser,S., Hempel,S., Feldpausch,M., Lamberth,S.,
            Villarroel,R., Gielen,J., Ardiles,W., Bents,O., Lemcke,K.,
            Kolesov,G., Mayer,K., Rudd,S., Schoof,H., Schueller,C.,
            Zaccaria,P., Mewes,H.W., Bevan,M. and Fransz,P.
  CONSRTM   Kazusa DNA Research Institute; Cold Spring Harbor and Washington
            University in St Louis Sequencing Consortium; European Union
            Arabidopsis Genome Sequencing Consortium
  TITLE     Sequence and analysis of chromosome 5 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 408 (6814), 823-826 (2000)
   PUBMED   11130714
REFERENCE   2  (bases 1 to 2259)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (19-OCT-2022) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 2259)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 2259)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003076).
            
            On Sep 12, 2016 this sequence version replaced NM_123317.3.
FEATURES             Location/Qualifiers
     source          1..2259
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="5"
                     /ecotype="Columbia"
     gene            1..2259
                     /gene="VIM3"
                     /locus_tag="AT5G39550"
                     /gene_synonym="MIJ24.3; MIJ24_3; ORTH1; ORTHRUS 1; VARIANT
                     IN METHYLATION 3"
                     /note="Encodes the VIM3/ORTH1 protein that is similar to
                     VIM1. This protein has an N-terminal PHD domain and two
                     RING domains surrounding an SRA domain. The protein has
                     been shown to bind to methylated cytosines of CG, CNG and
                     CNN motifs via its SRA domain but has a preference for the
                     former. This protein functions as an E3 ubiquitin ligase
                     in vitro with members of the UBC8 family E2s. Either of
                     the two RING domains present in the protein can promote
                     ubiquitylation in vitro, but, not the PHD domain.
                     Over-expression of ORTH1/VIM3 leads to decreased levels of
                     FWA methylation, increased levels of FWA transcripts, and
                     delayed flowering. Cen180 repeats are also hypomethylated
                     in plants overexpressing this protein."
                     /db_xref="Araport:AT5G39550"
                     /db_xref="GeneID:833951"
                     /db_xref="TAIR:AT5G39550"
     CDS             176..2029
                     /gene="VIM3"
                     /locus_tag="AT5G39550"
                     /gene_synonym="MIJ24.3; MIJ24_3; ORTH1; ORTHRUS 1; VARIANT
                     IN METHYLATION 3"
                     /inference="Similar to RNA sequence,
                     EST:INSD:BP615354.1,INSD:BP857153.1,INSD:ES103244.1,
                     INSD:EL993422.1,INSD:BP806510.1,INSD:EG516339.1"
                     /inference="similar to RNA sequence,
                     mRNA:INSD:AK221256.1,INSD:AK176778.1,INSD:BT010573.1"
                     /note="VARIANT IN METHYLATION 3 (VIM3); CONTAINS InterPro
                     DOMAIN/s: Zinc finger, RING-type, conserved site
                     (InterPro:IPR017907), Zinc finger, PHD-type, conserved
                     site (InterPro:IPR019786), Zinc finger, RING-type
                     (InterPro:IPR001841), Zinc finger, PHD-type
                     (InterPro:IPR001965), SRA-YDG (InterPro:IPR003105), Zinc
                     finger, C3HC4 RING-type (InterPro:IPR018957), Zinc finger,
                     FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis
                     thaliana protein match is: Zinc finger (C3HC4-type RING
                     finger) family protein (TAIR:AT1G66040.1); Has 6556 Blast
                     hits to 5308 proteins in 497 species: Archae - 0; Bacteria
                     - 14; Metazoa - 4783; Fungi - 431; Plants - 899; Viruses -
                     19; Other Eukaryotes - 410 (source: NCBI BLink)."
                     /codon_start=1
                     /product="Zinc finger (C3HC4-type RING finger) family
                     protein"
                     /protein_id="NP_198771.1"
                     /db_xref="GeneID:833951"
                     /db_xref="TAIR:AT5G39550"
                     /db_xref="Araport:AT5G39550"
                     /translation="

MAIETQLPCDGDGVCMRCQVNPPSEETLTCGTCVTPWHVPCLLPESLASSTGEWECPDCSGVVVPSAAPGTGNARPESSGSVLVAAIRAIQADETLTEAEKAKKRQKLMSGGGDDGVDEEEKKKLEIFCSICIQLPERPITTPCGHNFCLKCFEKWAVGQGKLTCMICRSKIPRHVAKNPRINLALVSAIRLANVTKCSVEATAAKVHHIIRNQDRPEKAFTTERAVKTGKANAASGKFFVTIPRDHFGPIPAENDVTRKQGVLVGESWEDRQECRQWGAHFPHIAGIAGQSAVGAQSVALSGGYDDDEDHGEWFLYTGSGGRDLSGNKRINKKQSSDQAFKNMNESLRLSCKMGYPVRVVRSWKEKRSAYAPAEGVRYDGVYRIEKCWSNVGVQGSFKVCRYLFVRCDNEPAPWTSDEHGDRPRPLPNVPELETAADLFVRKESPSWDFDEAEGRWKWMKSPPVSRMALDPEERKKNKRAKNTMKARLLKEFSCQICREVLSLPVTTPCAHNFCKACLEAKFAGITQLRERSNGGRKLRAKKNIMTCPCCTTDLSEFLQNPQVNREMMEIIENFKKSEEEADASISEEEEEESEPPTKKIKMDNNSVGGSGTSLSA"

     misc_feature    215..352
                     /gene="VIM3"
                     /locus_tag="AT5G39550"
                     /gene_synonym="MIJ24.3; MIJ24_3; ORTH1; ORTHRUS 1; VARIANT
                     IN METHYLATION 3"
                     /note="PHD zinc finger; Region: PHD; smart00249"
                     /db_xref="CDD:214584"
     misc_feature    order(254..265,275..277,335..337)
                     /gene="VIM3"
                     /locus_tag="AT5G39550"
                     /gene_synonym="MIJ24.3; MIJ24_3; ORTH1; ORTHRUS 1; VARIANT
                     IN METHYLATION 3"
                     /note="histone H3 binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:276966"
     misc_feature    467..>643
                     /gene="VIM3"
                     /locus_tag="AT5G39550"
                     /gene_synonym="MIJ24.3; MIJ24_3; ORTH1; ORTHRUS 1; VARIANT
                     IN METHYLATION 3"
                     /note="E3 ubiquitin-protein ligase RMA2; Provisional;
                     Region: PLN03208"
                     /db_xref="CDD:178747"
     misc_feature    560..682
                     /gene="VIM3"
                     /locus_tag="AT5G39550"
                     /gene_synonym="MIJ24.3; MIJ24_3; ORTH1; ORTHRUS 1; VARIANT
                     IN METHYLATION 3"
                     /note="The superfamily of RING finger (Really Interesting
                     New Gene) domain and U-box domain; Region: RING_Ubox;
                     cl17238"
                     /db_xref="CDD:418438"
     misc_feature    order(560..562,569..571,605..607,611..613,620..622,
                     629..631,668..670,677..679)
                     /gene="VIM3"
                     /locus_tag="AT5G39550"
                     /gene_synonym="MIJ24.3; MIJ24_3; ORTH1; ORTHRUS 1; VARIANT
                     IN METHYLATION 3"
                     /note="cross-brace motif; other site"
                     /db_xref="CDD:319361"
     misc_feature    914..1402
                     /gene="VIM3"
                     /locus_tag="AT5G39550"
                     /gene_synonym="MIJ24.3; MIJ24_3; ORTH1; ORTHRUS 1; VARIANT
                     IN METHYLATION 3"
                     /note="SAD/SRA domain; Region: SAD_SRA; pfam02182"
                     /db_xref="CDD:396656"
     misc_feature    <1517..1732
                     /gene="VIM3"
                     /locus_tag="AT5G39550"
                     /gene_synonym="MIJ24.3; MIJ24_3; ORTH1; ORTHRUS 1; VARIANT
                     IN METHYLATION 3"
                     /note="RING-finger-containing E3 ubiquitin ligase
                     [Posttranslational modification, protein turnover,
                     chaperones]; Region: PEX10; COG5574"
                     /db_xref="CDD:227861"
     misc_feature    1652..1840
                     /gene="VIM3"
                     /locus_tag="AT5G39550"
                     /gene_synonym="MIJ24.3; MIJ24_3; ORTH1; ORTHRUS 1; VARIANT
                     IN METHYLATION 3"
                     /note="The superfamily of RING finger (Really Interesting
                     New Gene) domain and U-box domain; Region: RING_Ubox;
                     cl17238"
                     /db_xref="CDD:418438"
     misc_feature    order(1658..1660,1667..1669,1703..1705,1709..1711,
                     1718..1720,1727..1729,1817..1819,1826..1828)
                     /gene="VIM3"
                     /locus_tag="AT5G39550"
                     /gene_synonym="MIJ24.3; MIJ24_3; ORTH1; ORTHRUS 1; VARIANT
                     IN METHYLATION 3"
                     /note="cross-brace motif; other site"
                     /db_xref="CDD:319361"
ORIGIN      

atttttttcttttttaggtttttacaaatcattttgaaattcactcttcgccttccccaaaatttcaaaacccgcctcttcacttttcgccttcctctacttatttagcctaaatctctcataaatctggaaaacaacattttctctctaaatctctctctcactcgtttcaacaatggcgattgaaactcagcttccttgcgacggtgacggtgtgtgtatgcggtgtcaggtgaatcctccgtcagaagagactctcacttgtggcacgtgcgtcactccatggcacgtgccgtgtctcctccccgaatcactcgcttcttccactggagagtgggagtgtcccgattgctccggcgttgtcgttccctccgccgctccgggtaccggaaacgctcgacctgaatcttccggttcagttctcgttgctgcgatccgtgcgattcaggctgatgagactttaaccgaagctgagaaagccaaaaaaaggcagaaactgatgagtgggggtggtgacgatggtgtcgatgaagaagagaagaagaagttagaaatcttttgttctatttgcattcaattgccagaaagacctatcacgacaccgtgtgggcacaatttctgtttgaaatgtttcgagaaatgggcagtaggtcaagggaagctaacttgtatgatatgccgaagcaaaattccgagacatgtggcaaaaaatcctcgcatcaacttagctctagtttctgctattcgtttagcaaatgttaccaaatgttctgttgaggcaactgcagccaaggttcatcatattatccgcaaccaagaccgtcctgagaaagcatttactaccgagcgggcagtaaaaactgggaaagctaatgctgctagcggtaagttttttgtgacaatacctcgtgatcattttggtcccataccagctgagaatgatgtcactagaaagcaaggtgttttggttggagaatcttgggaggacaggcaagagtgtaggcagtggggagctcatttcccgcatattgctggcattgccgggcaatcagcggttggagctcagtctgtggccctctctggaggttatgacgatgatgaggatcatggtgaatggtttctctacacaggaagtggtggaagggatctcagtggaaacaaaagaattaacaagaaacagtcgtctgaccaggcgtttaaaaacatgaatgaatctctaagacttagttgcaaaatgggctatcctgtccgagttgtcaggtcttggaaggagaagcgttctgcatatgcccctgctgaaggtgtgagatatgatggggtctatcgaattgagaagtgctggagtaatgttggagtacagggttcttttaaggtctgtcgttacctgtttgttagatgtgacaatgagccagctccatggaccagtgatgagcatggcgatcgtccaagaccgttgcctaatgttccggagcttgagactgctgctgacctgtttgtgagaaaggagagtccatcatgggatttcgatgaagctgagggtcgttggaaatggatgaagtctcctcctgttagcagaatggctttggatcctgaggagaggaagaagaataagagagcaaaaaatactatgaaggccagacttctgaaagaatttagttgccaaatctgtcgggaagtgctgagtcttccagtgacgacgccttgtgcacacaacttctgcaaagcatgcttagaagcgaagtttgctgggataactcaactgagagagagaagcaatggcggacgtaaactacgtgcaaagaagaacatcatgacctgcccttgctgcacgacggatctctccgagtttctccaaaacccgcaggtgaacagagagatgatggagataatagagaattttaagaagagtgaggaagaggctgatgcatccatttctgaagaagaagaagaagaatccgaacctccaactaagaagattaagatggataacaactctgttggtggtagtggtacaagtctctcagcttaaggagctctttagtttttcgaaacaaacttcctttctttttttggtaatattccgcaaacgtctgtgaagtttgcattgcgacttatcatttttattttaaaacttatcagaaattgttcgaatcttttttttccgttacatataaattcaacattagtatattactttaaattttcgtggtcagtgagttaccacaacaaattctctataaactaatatatcgataaatt

//