GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-02 07:44:12, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_116532               1055 bp    mRNA    linear   PLN 20-OCT-2022
DEFINITION  Arabidopsis thaliana endoplasmic reticulum auxin binding protein 1
            (ABP1), mRNA.
ACCESSION   NM_116532
VERSION     NM_116532.3
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 1055)
  AUTHORS   Mayer,K., Schuller,C., Wambutt,R., Murphy,G., Volckaert,G.,
            Pohl,T., Dusterhoft,A., Stiekema,W., Entian,K.D., Terryn,N.,
            Harris,B., Ansorge,W., Brandt,P., Grivell,L., Rieger,M.,
            Weichselgartner,M., de Simone,V., Obermaier,B., Mache,R.,
            Muller,M., Kreis,M., Delseny,M., Puigdomenech,P., Watson,M.,
            Schmidtheini,T., Reichert,B., Portatelle,D., Perez-Alonso,M.,
            Boutry,M., Bancroft,I., Vos,P., Hoheisel,J., Zimmermann,W.,
            Wedler,H., Ridley,P., Langham,S.A., McCullagh,B., Bilham,L.,
            Robben,J., Van der Schueren,J., Grymonprez,B., Chuang,Y.J.,
            Vandenbussche,F., Braeken,M., Weltjens,I., Voet,M., Bastiaens,I.,
            Aert,R., Defoor,E., Weitzenegger,T., Bothe,G., Ramsperger,U.,
            Hilbert,H., Braun,M., Holzer,E., Brandt,A., Peters,S., van
            Staveren,M., Dirske,W., Mooijman,P., Klein Lankhorst,R., Rose,M.,
            Hauf,J., Kotter,P., Berneiser,S., Hempel,S., Feldpausch,M.,
            Lamberth,S., Van den Daele,H., De Keyser,A., Buysshaert,C.,
            Gielen,J., Villarroel,R., De Clercq,R., Van Montagu,M., Rogers,J.,
            Cronin,A., Quail,M., Bray-Allen,S., Clark,L., Doggett,J., Hall,S.,
            Kay,M., Lennard,N., McLay,K., Mayes,R., Pettett,A.,
            Rajandream,M.A., Lyne,M., Benes,V., Rechmann,S., Borkova,D.,
            Blocker,H., Scharfe,M., Grimm,M., Lohnert,T.H., Dose,S., de
            Haan,M., Maarse,A., Schafer,M., Muller-Auer,S., Gabel,C., Fuchs,M.,
            Fartmann,B., Granderath,K., Dauner,D., Herzl,A., Neumann,S.,
            Argiriou,A., Vitale,D., Liguori,R., Piravandi,E., Massenet,O.,
            Quigley,F., Clabauld,G., Mundlein,A., Felber,R., Schnabl,S.,
            Hiller,R., Schmidt,W., Lecharny,A., Aubourg,S., Chefdor,F.,
            Cooke,R., Berger,C., Montfort,A., Casacuberta,E., Gibbons,T.,
            Weber,N., Vandenbol,M., Bargues,M., Terol,J., Torres,A.,
            Perez-Perez,A., Purnelle,B., Bent,E., Johnson,S., Tacon,D.,
            Jesse,T., Heijnen,L., Schwarz,S., Scholler,P., Heber,S., Francs,P.,
            Bielke,C., Frishman,D., Haase,D., Lemcke,K., Mewes,H.W.,
            Stocker,S., Zaccaria,P., Bevan,M., Wilson,R.K., de la Bastide,M.,
            Habermann,K., Parnell,L., Dedhia,N., Gnoj,L., Schutz,K., Huang,E.,
            Spiegel,L., Sehkon,M., Murray,J., Sheet,P., Cordes,M.,
            Abu-Threideh,J., Stoneking,T., Kalicki,J., Graves,T., Harmon,G.,
            Edwards,J., Latreille,P., Courtney,L., Cloud,J., Abbott,A.,
            Scott,K., Johnson,D., Minx,P., Bentley,D., Fulton,B., Miller,N.,
            Greco,T., Kemp,K., Kramer,J., Fulton,L., Mardis,E., Dante,M.,
            Pepin,K., Hillier,L., Nelson,J., Spieth,J., Ryan,E., Andrews,S.,
            Geisel,C., Layman,D., Du,H., Ali,J., Berghoff,A., Jones,K.,
            Drone,K., Cotton,M., Joshu,C., Antonoiu,B., Zidanic,M., Strong,C.,
            Sun,H., Lamar,B., Yordan,C., Ma,P., Zhong,J., Preston,R., Vil,D.,
            Shekher,M., Matero,A., Shah,R., Swaby,I.K., O'Shaughnessy,A.,
            Rodriguez,M., Hoffmann,J., Till,S., Granat,S., Shohdy,N.,
            Hasegawa,A., Hameed,A., Lodhi,M., Johnson,A., Chen,E., Marra,M.,
            Martienssen,R. and McCombie,W.R.
  TITLE     Sequence and analysis of chromosome 4 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 402 (6763), 769-777 (1999)
   PUBMED   10617198
REFERENCE   2  (bases 1 to 1055)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (19-OCT-2022) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 1055)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 1055)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003075).
            
            On Sep 12, 2016 this sequence version replaced NM_116532.2.
FEATURES             Location/Qualifiers
     source          1..1055
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="4"
                     /ecotype="Columbia"
     gene            1..1055
                     /gene="ABP1"
                     /locus_tag="AT4G02980"
                     /gene_synonym="ABP; AT-ERABP1; endoplasmic reticulum auxin
                     binding protein 1; T4I9.14; T4I9_14"
                     /note="Auxin binding protein involved in cell elongation
                     and cell division. ABP1 is ubiquitinated in vitro and in
                     planta by AtRma2."
                     /db_xref="Araport:AT4G02980"
                     /db_xref="GeneID:828120"
                     /db_xref="TAIR:AT4G02980"
     CDS             160..756
                     /gene="ABP1"
                     /locus_tag="AT4G02980"
                     /gene_synonym="ABP; AT-ERABP1; endoplasmic reticulum auxin
                     binding protein 1; T4I9.14; T4I9_14"
                     /inference="Similar to RNA sequence,
                     EST:INSD:EL132735.1,INSD:ES058604.1,INSD:DR237539.1,
                     INSD:DR237540.1,INSD:DR237534.1,INSD:DR237532.1,
                     INSD:DR377148.1,INSD:AI999148.1,INSD:AV822080.1,
                     INSD:ES198127.1,INSD:DR202912.1,INSD:DR237529.1,
                     INSD:DR237526.1,INSD:DR375275.1,INSD:ES058936.1,
                     INSD:BP656634.1,INSD:DR237537.1,INSD:EL140402.1,
                     INSD:DR378703.1,INSD:DR237527.1,INSD:DR237531.1,
                     INSD:AV782715.1,INSD:BP814675.1,INSD:EH936821.1,
                     INSD:EL038128.1,INSD:BP600783.1,INSD:DR237538.1,
                     INSD:BP815740.1,INSD:DR202913.1,INSD:DR202909.1,
                     INSD:EH898980.1,INSD:EL000984.1,INSD:EL185126.1"
                     /inference="Similar to RNA sequence,
                     mRNA:INSD:AY087315.1,INSD:AY093754.1,INSD:AF389278.1,
                     INSD:S40550.1"
                     /note="endoplasmic reticulum auxin binding protein 1
                     (ABP1); FUNCTIONS IN: auxin binding; INVOLVED IN: positive
                     regulation of cell division, positive regulation of cell
                     size, unidimensional cell growth, positive regulation of
                     DNA endoreduplication, cytokinesis; LOCATED IN:
                     endomembrane system, endoplasmic reticulum lumen;
                     EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13
                     growth stages; CONTAINS InterPro DOMAIN/s: Auxin-binding
                     protein (InterPro:IPR000526), Cupin, RmlC-type
                     (InterPro:IPR011051), RmlC-like jelly roll fold
                     (InterPro:IPR014710); Has 186 Blast hits to 186 proteins
                     in 64 species: Archae - 10; Bacteria - 50; Metazoa - 0;
                     Fungi - 0; Plants - 107; Viruses - 0; Other Eukaryotes -
                     19 (source: NCBI BLink)."
                     /codon_start=1
                     /product="endoplasmic reticulum auxin binding protein 1"
                     /protein_id="NP_192207.1"
                     /db_xref="GeneID:828120"
                     /db_xref="TAIR:AT4G02980"
                     /db_xref="Araport:AT4G02980"
                     /translation="
MIVLSVGSASSSPIVVVFSVALLLFYFSETSLGAPCPINGLPIVRNISDLPQDNYGRPGLSHMTVAGSVLHGMKEVEIWLQTFAPGSETPIHRHSCEEVFVVLKGSGTLYLAETHGNFPGKPIEFPIFANSTIHIPINDAHQVKNTGHEDLQVLVIISRPPIKIFIYEDWFMPHTAARLKFPYYWDEQCIQESQKDEL"
     misc_feature    265..753
                     /gene="ABP1"
                     /locus_tag="AT4G02980"
                     /gene_synonym="ABP; AT-ERABP1; endoplasmic reticulum auxin
                     binding protein 1; T4I9.14; T4I9_14"
                     /note="Auxin binding protein; Region: Auxin_BP; pfam02041"
                     /db_xref="CDD:396569"
     misc_feature    order(286..300,352..354,376..387,391..393,448..450,
                     454..456,460..462,484..486,490..492,532..534,538..543,
                     547..561,619..621,625..627,631..636)
                     /gene="ABP1"
                     /locus_tag="AT4G02980"
                     /gene_synonym="ABP; AT-ERABP1; endoplasmic reticulum auxin
                     binding protein 1; T4I9.14; T4I9_14"
                     /note="homodimer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:380349"
     misc_feature    order(337..339,394..396,400..402,424..429,433..435,
                     439..441,451..453,457..459,580..582,712..714)
                     /gene="ABP1"
                     /locus_tag="AT4G02980"
                     /gene_synonym="ABP; AT-ERABP1; endoplasmic reticulum auxin
                     binding protein 1; T4I9.14; T4I9_14"
                     /note="active site"
                     /db_xref="CDD:380349"
ORIGIN      
tcgaaaatgaaaaatagtattttctgactcttttttatagtatcgggtttaattcagaaatatataaagctttggggtctgtttcgaagtatctttactcttttaacagttctgagacttctaaagagaggaaaattagttcgtcgaagcatcgagaaaatgatcgtactttctgttggttccgcttcttcatctccgatcgtcgtcgtcttttccgtcgcgcttcttctgttctacttctctgaaacttctctaggagctccttgtcccatcaatggcttgccaatcgtgaggaatattagtgaccttcctcaggataactatggaagaccaggtctttcccacatgactgttgctggctccgtattgcatggaatgaaagaggttgaaatatggcttcagacatttgctccaggttcagagacaccaattcacaggcactcctgtgaagaggtttttgttgtcctaaagggcagtggtactctgtatctcgctgaaacacatggaaatttccctgggaaaccaatcgaatttccaatctttgccaacagtacaattcatattccgatcaatgatgctcatcaggtcaaaaacaccggtcatgaggacctgcaggtgttggttatcatatctcggccgcctattaaaatcttcatctacgaagactggtttatgccacacactgctgcaaggctgaagttcccttactattgggatgagcaatgcattcaagaatcacaaaaagacgagctttaaagcaaagtccgaggctaaaagcaagcacaacctttagatagtaaaatcatagttgaggttttgtgacactacgtagatactggtaaattggcaaggattttacatgaatgttgttgttaccagaaagtaaataaatgttcaatctttgatgttcttaagtaagtgagtcctattggtcatgaaaatatgtaagtgtgcacatcttgattgcatttgcgataaatttatagagtttcactcacttttattttcctcttctatattcaaatcatagctcttcgaagacaagaggacatcag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]