GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-27 08:00:54, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_114260               4596 bp    mRNA    linear   PLN 20-OCT-2022
DEFINITION  Arabidopsis thaliana dicer-like 3 (DCL3), partial mRNA.
ACCESSION   NM_114260
VERSION     NM_114260.1
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 4596)
  AUTHORS   Salanoubat,M., Lemcke,K., Rieger,M., Ansorge,W., Unseld,M.,
            Fartmann,B., Valle,G., Blocker,H., Perez-Alonso,M., Obermaier,B.,
            Delseny,M., Boutry,M., Grivell,L.A., Mache,R., Puigdomenech,P., De
            Simone,V., Choisne,N., Artiguenave,F., Robert,C., Brottier,P.,
            Wincker,P., Cattolico,L., Weissenbach,J., Saurin,W., Quetier,F.,
            Schafer,M., Muller-Auer,S., Gabel,C., Fuchs,M., Benes,V.,
            Wurmbach,E., Drzonek,H., Erfle,H., Jordan,N., Bangert,S.,
            Wiedelmann,R., Kranz,H., Voss,H., Holland,R., Brandt,P.,
            Nyakatura,G., Vezzi,A., D'Angelo,M., Pallavicini,A., Toppo,S.,
            Simionati,B., Conrad,A., Hornischer,K., Kauer,G., Lohnert,T.H.,
            Nordsiek,G., Reichelt,J., Scharfe,M., Schon,O., Bargues,M.,
            Terol,J., Climent,J., Navarro,P., Collado,C., Perez-Perez,A.,
            Ottenwalder,B., Duchemin,D., Cooke,R., Laudie,M., Berger-Llauro,C.,
            Purnelle,B., Masuy,D., de Haan,M., Maarse,A.C., Alcaraz,J.P.,
            Cottet,A., Casacuberta,E., Monfort,A., Argiriou,A., flores,M.,
            Liguori,R., Vitale,D., Mannhaupt,G., Haase,D., Schoof,H., Rudd,S.,
            Zaccaria,P., Mewes,H.W., Mayer,K.F., Kaul,S., Town,C.D., Koo,H.L.,
            Tallon,L.J., Jenkins,J., Rooney,T., Rizzo,M., Walts,A.,
            Utterback,T., Fujii,C.Y., Shea,T.P., Creasy,T.H., Haas,B.,
            Maiti,R., Wu,D., Peterson,J., Van Aken,S., Pai,G., Militscher,J.,
            Sellers,P., Gill,J.E., Feldblyum,T.V., Preuss,D., Lin,X.,
            Nierman,W.C., Salzberg,S.L., White,O., Venter,J.C., Fraser,C.M.,
            Kaneko,T., Nakamura,Y., Sato,S., Kato,T., Asamizu,E., Sasamoto,S.,
            Kimura,T., Idesawa,K., Kawashima,K., Kishida,Y., Kiyokawa,C.,
            Kohara,M., Matsumoto,M., Matsuno,A., Muraki,A., Nakayama,S.,
            Nakazaki,N., Shinpo,S., Takeuchi,C., Wada,T., Watanabe,A.,
            Yamada,M., Yasuda,M. and Tabata,S.
  CONSRTM   European Union Chromosome 3 Arabidopsis Sequencing Consortium;
            Institute for Genomic Research; Kazusa DNA Research Institute
  TITLE     Sequence and analysis of chromosome 3 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 408 (6814), 820-822 (2000)
   PUBMED   11130713
REFERENCE   2  (bases 1 to 4596)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (19-OCT-2022) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 4596)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 4596)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003074).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..4596
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="3"
                     /ecotype="Columbia"
     gene            <1..>4596
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="Encodes a ribonuclease III family protein that is
                     required for endogenous RDR2-dependent siRNA (but not
                     miRNA) formation."
                     /db_xref="Araport:AT3G43920"
                     /db_xref="GeneID:823508"
                     /db_xref="TAIR:AT3G43920"
     CDS             1..4596
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /inference="Similar to RNA sequence,
                     EST:INSD:EG422302.1,INSD:EG422290.1,INSD:EG422304.1,
                     INSD:EG422298.1,INSD:ES088132.1,INSD:EG422292.1,
                     INSD:EG422300.1"
                     /inference="Similar to RNA sequence, mRNA:INSD:DQ479972.1"
                     /note="dicer-like 3 (DCL3); CONTAINS InterPro DOMAIN/s:
                     DNA/RNA helicase, DEAD/DEAH box type, N-terminal
                     (InterPro:IPR011545), DEAD-like helicase, N-terminal
                     (InterPro:IPR014001), Argonaute/Dicer protein, PAZ
                     (InterPro:IPR003100), DNA/RNA helicase, C-terminal
                     (InterPro:IPR001650), Helicase, superfamily 1/2,
                     ATP-binding domain (InterPro:IPR014021), Ribonuclease III
                     (InterPro:IPR000999); BEST Arabidopsis thaliana protein
                     match is: dicer-like 4 (TAIR:AT5G20320.1); Has 13386 Blast
                     hits to 8472 proteins in 2623 species: Archae - 174;
                     Bacteria - 7922; Metazoa - 1543; Fungi - 728; Plants -
                     598; Viruses - 37; Other Eukaryotes - 2384 (source: NCBI
                     BLink)."
                     /codon_start=1
                     /product="dicer-like 3"
                     /protein_id="NP_189978.1"
                     /db_xref="GeneID:823508"
                     /db_xref="TAIR:AT3G43920"
                     /db_xref="Araport:AT3G43920"
                     /translation="
MHSSLEPEKMEEGGGSNSLKRKFSEIDGDQNLDSVSSPMMTDSNGSYELKVYEVAKNRNIIAVLGTGIDKSEITKRLIKAMGSSDTDKRLIIFLAPTVNLQCCEIRALVNLKVEEYFGAKGVDKWTSQRWDEEFSKHDVLVMTPQILLDVLRSAFLKLEMVCLLIIDECHHTTGNHPYAKLMKIFNPEEREGVEKFATTVKEGPILYNPSPSCSLELKEKLETSHLKFDASLRRLQELGKDSFLNMDNKFETYQKRLSIDYREILHCLDNLGLICAHLAAEVCLEKISDTKEESETYKECSMVCKEFLEDILSTIGVYLPQDDKSLVDLQQNHLSAVISGHVSPKLKELFHLLDSFRGDKQKQCLILVERIITAKVIERFVKKEASLAYLNVLYLTENNPSTNVSAQKMQIEIPDLFQHGKVNLLFITDVVEEGFQVPDCSCMVCFDLPKTMCSYSQSQKHAKQSNSKSIMFLERGNPKQRDHLHDLMRREVLIQDPEAPNLKSCPPPVKNGHGVKEIGSMVIPDSNITVSEEAASTQTMSDPPSRNEQLPPCKKLRLDNNLLQSNGKEKVASSKSKSSSSAAGSKKRKELHGTTCANALSGTWGENIDGATFQAYKFDFCCNISGEVYSSFSLLLESTLAEDVGKVEMDLYLVRKLVKASVSPCGQIRLSQEELVKAKYFQQFFFNGMFGKLFVGSKSQGTKREFLLQTDTSSLWHPAFMFLLLPVETNDLASSATIDWSAINSCASIVEFLKKNSLLDLRDSDGNQCNTSSGQEVLLDDKMEETNLIHFANASSDKNSLEELVVIAIHTGRIYSIVEAVSDSSAMSPFEVDASSGYATYAEYFNKKYGIVLAHPNQPLMKLKQSHHAHNLLVDFNEEMVVKTEPKAGNVRKRKPNIHAHLPPELLARIDVPRAVLKSIYLLPSVMHRLESLMLASQLREEIDCSIDNFSISSTSILEAVTTLTCPESFSMERLELLGDSVLKYVASCHLFLKYPDKDEGQLSRQRQSIISNSNLHRLTTSRKLQGYIRNGAFEPRRWTAPGQFSLFPVPCKCGIDTREVPLDPKFFTENMTIKIGKSCDMGHRWVVSKSVSDCAEALIGAYYVSGGLSASLHMMKWLGIDVDFDPNLVVEAINRVSLRCYIPKEDELIELERKIQHEFSAKFLLKEAITHSSLRESYSYERLEFLGDSVLDFLITRHLFNTYEQTGPGEMTDLRSACVNNENFAQVAVKNNLHTHLQRCATVLETQINDYLMSFQKPDETGRSIPSIQGPKALGDVVESIAGALLIDTRLDLDQVWRVFEPLLSPLVTPDKLQLPPYRELNELCDSLGYFFRVKCSNDGVKAQATIQLQLDDVLLTGDGSEQTNKLALGKAASHLLTQLEKRNISRKTSLGDNQSSMDVNLACNHSDRETLTSETTEIQSIVIPFIGPINMKKGGPRGTLHEFCKKHLWPMPTFDTSEEKSRTPFEFIDGGEKRTSFSSFTSTITLRIPNREAVMYAGEARPDKKSSFDSAVVELLYELERRKIVIIQK"
     misc_feature    136..>555
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="DEXH-box helicase domain of endoribonuclease Dicer;
                     Region: DEXHc_dicer; cd18034"
                     /db_xref="CDD:350792"
     misc_feature    order(286..291,349..354,427..429,433..438,445..447,
                     520..528)
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="nucleic acid binding site [nucleotide binding];
                     other site"
                     /db_xref="CDD:350792"
     misc_feature    1024..1419
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="C-terminal helicase domain of the endoribonuclease
                     Dicer; Region: SF2_C_dicer; cd18802"
                     /db_xref="CDD:350189"
     misc_feature    order(1105..1113,1288..1290,1345..1347,1351..1353)
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:350189"
     misc_feature    order(1300..1302,1306..1308,1381..1383,1387..1389)
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:350189"
     misc_feature    2323..2739
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="PAZ domain, CAF_like subfamily. CAF (for carpel
                     factory) is a plant homolog of Dicer. CAF has been
                     implicated in flower morphogenesis and in early
                     Arabidopsis development and might function through
                     posttranscriptional regulation of specific mRNA...;
                     Region: PAZ_CAF_like; cd02844"
                     /db_xref="CDD:239210"
     misc_feature    order(2443..2445,2521..2523,2533..2535,2587..2589,
                     2698..2700,2704..2706)
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239210"
     misc_feature    2869..3378
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="Ribonuclease III C terminal domain. This group
                     consists of eukaryotic, bacterial and archeal ribonuclease
                     III (RNAse III) proteins. RNAse III is a double stranded
                     RNA-specific endonuclease. Prokaryotic RNAse III is
                     important in post-transcriptional...; Region: RIBOc;
                     cd00593"
                     /db_xref="CDD:238333"
     misc_feature    order(2917..2922,2929..2934,2941..2943,2950..2955,
                     2962..2967,2971..2979,3007..3009,3310..3312,3337..3339)
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238333"
     misc_feature    order(2917..2919,2926..2928,2938..2940,3280..3282,
                     3289..3291)
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="active site"
                     /db_xref="CDD:238333"
     misc_feature    order(2926..2928,3280..3282,3289..3291)
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="metal binding site [ion binding]; metal-binding
                     site"
                     /db_xref="CDD:238333"
     misc_feature    3493..3936
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="Ribonuclease III C terminal domain. This group
                     consists of eukaryotic, bacterial and archeal ribonuclease
                     III (RNAse III) proteins. RNAse III is a double stranded
                     RNA-specific endonuclease. Prokaryotic RNAse III is
                     important in post-transcriptional...; Region: RIBOc;
                     cd00593"
                     /db_xref="CDD:238333"
     misc_feature    order(3544..3549,3556..3561,3568..3570,3577..3582,
                     3589..3594,3598..3606,3634..3636,3859..3861,3892..3894)
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238333"
     misc_feature    order(3544..3546,3553..3555,3565..3567,3829..3831,
                     3838..3840)
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="active site"
                     /db_xref="CDD:238333"
     misc_feature    order(3553..3555,3829..3831,3838..3840)
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="metal binding site [ion binding]; metal-binding
                     site"
                     /db_xref="CDD:238333"
     misc_feature    4327..4569
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="double-stranded RNA binding motif (DSRM)
                     superfamily; Region: DSRM_SF; cl00054"
                     /db_xref="CDD:444671"
     misc_feature    order(4327..4332,4336..4338,4444..4446,4513..4521,
                     4528..4530)
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="RNA binding site [nucleotide binding]; other site"
                     /db_xref="CDD:380679"
ORIGIN      
atgcattcgtcgttggagccggagaaaatggaggaaggtgggggaagcaattcgcttaagagaaaattctctgaaatcgatggagatcaaaatcttgattctgtctcttctcctatgatgactgactctaatggtagttatgaattgaaagtgtacgaggttgctaagaacaggaacataattgctgttttggggacagggattgataagtcagagatcactaagaggcttatcaaagctatgggttcttctgatacagacaaaagattgataattttcttggccccaactgtgaatcttcaatgctgtgagatcagagcacttgtgaatttgaaagttgaagagtactttggagctaaaggagttgataaatggacatctcagcgctgggatgaggaatttagcaagcacgatgttttagttatgactcctcaaatattattggatgtccttagaagtgcattcctgaaactagagatggtatgtcttctaataatagatgaatgccaccataccactggcaatcatccctatgcgaagttaatgaagatttttaatcctgaagagcgtgaaggagtggaaaagtttgctacaacggttaaagaaggtccaatattgtataacccatcaccatcctgtagtttggaattgaaagaaaagttagaaacttcacacctcaagtttgatgcttctcttagaaggcttcaagagttgggaaaagacagttttctgaatatggataataagtttgagacatatcaaaagagattgtctatcgactacagagagattttgcattgccttgataatcttggcctgatttgcgcacacttggcggctgaagtctgcttggagaaaatctcagatacgaaagaggaaagtgaaacttataaagaatgctcaatggtgtgcaaggaatttcttgaggatattttatccaccattggggtgtatttgccgcaagatgataagagtctggtagatttgcagcaaaaccatctgtcagcagtaatttctgggcatgtatctccaaagctaaaagaactcttccatctattggattcctttagaggtgacaagcaaaagcagtgccttattttagttgagagaattataactgcgaaagtgatcgaaagattcgttaagaaagaagcctctttggcttaccttaatgtcttgtatttaaccgaaaacaacccctccaccaatgtatcggcacagaaaatgcaaattgaaatccctgatttatttcaacatggcaaggtgaatcttttattcatcacagatgtggttgaagagggatttcaggttccagattgctcatgcatggtttgttttgacctgcccaaaacaatgtgtagttactcgcagtctcaaaaacatgccaaacagagtaattctaagtctatcatgtttcttgaaagagggaacccgaagcaaagagaccatctgcatgaccttatgcgaagagaagtcctaattcaagatccagaagctccaaacttgaaatcgtgtccacctccagtgaaaaatggacacggtgtgaaggagattggatccatggttatcccagattctaacataactgtatctgaggaagcagcttccacacaaactatgagtgatcctcctagcagaaatgagcagttaccaccgtgtaaaaagttacgcttggataacaatctcttacaatccaacggcaaagagaaggttgcctcttctaaaagtaaatcatcttcatcggctgcaggttcaaaaaaacgtaaggagttgcacggaacaacctgtgcaaacgcattgtcaggaacctggggagaaaatattgatggcgccacctttcaggcttataagtttgacttctgttgtaatatttctggcgaagtatactcgagtttctctcttttgcttgagtcaactctcgccgaggatgttggtaaagttgagatggacctttacttggtcaggaagcttgtcaaggcttctgtctcaccttgtggccagatacgtttgagtcaagaggagctggtcaaagcaaaatattttcagcagtttttctttaatggcatgtttggaaagttgtttgttggatctaagtcacagggaacaaagagagaatttttgcttcaaactgacactagttctctttggcaccctgcctttatgtttctactgctaccagttgaaacaaatgatctagcttcgagtgcgacaattgattggtcagctatcaactcctgtgcctcaatagttgagttcttgaagaaaaattctcttcttgatcttcgggatagtgatgggaatcagtgcaatacctcatccggtcaggaagtcttactagacgataaaatggaagaaacgaatctgattcattttgccaatgcttcgtctgataaaaatagtctcgaagaacttgtggtcattgcaattcatactggacggatatactctatagttgaagccgtaagcgattcttctgctatgagcccctttgaggtggatgcctcatcaggctatgctacttatgcagaatattttaacaaaaagtatgggattgttttagcgcacccgaaccagccgttgatgaagttgaagcagagtcaccatgcgcacaaccttttagtcgacttcaatgaagagatggttgtgaagacagaaccaaaagctggcaatgttaggaaaagaaaaccgaatatccatgcgcatttgcctccagagcttttggctagaattgatgtaccgcgtgctgtgctaaaatcaatctacttgctgccttcagtgatgcaccgcctagagtctctaatgttggccagccagcttagggaagagattgattgtagcatagataacttcagtatatcaagtacatcgattcttgaagcagttacaacacttacatgccccgaatcattttcaatggagcggttggaactgctcggggattcagtcttgaagtatgttgcgagctgtcatctattccttaagtatcctgacaaagatgaggggcaactatcacggcagagacaatcgattatatctaactcaaatcttcaccgcttgacaaccagtcgcaaactacagggatacataagaaatggcgcttttgaaccgcgtcgctggactgcacctggtcaattttctctttttcctgttccttgcaagtgtgggattgatactagagaagtaccattggacccaaaattcttcacagaaaacatgactatcaaaataggcaagtcttgcgacatgggtcatagatgggtagtttcaaaatctgtatcagattgcgctgaggccctgattggtgcctattatgtaagcggtggattgtctgcttctctccatatgatgaaatggctcggtattgacgtcgattttgacccaaacctagtcgttgaagccatcaatagagtttctctacggtgttacattcctaaagaagatgagctcatagagttggagagaaagatccaacatgaattctctgcaaagtttcttttaaaagaggctatcacacactcctctcttcgtgaatcctattcatacgagagattagagtttcttggcgattctgtactggattttctaataacccgtcatctttttaacacctacgaacaaactgggcctggagagatgaccgatcttcgttctgcatgtgtaaacaatgaaaattttgcgcaagttgcagtgaaaaataacctgcatacccaccttcaacgctgtgctacggttctcgagactcaaataaacgactatctgatgtcctttcaaaagccagatgagactggtagatcaatcccttcaatacagggccctaaggctcttggagatgttgtggagagtatcgctggagcattgctgatcgatacgaggttagatctcgatcaagtgtggagagtctttgagccgttgctttctccacttgtaactccagataaacttcagcttcctccataccgggagctcaatgagctatgcgactctcttgggtatttctttcgagtgaaatgttcaaatgatggtgtcaaagcacaagccacgatccagttgcagctggatgatgttcttttaactggagatggatctgaacagacaaataaactggccttgggaaaagcagcttcacatctgcttacacaacttgagaagagaaacatttcacgtaaaacctcgctcggggataatcaaagttccatggatgtcaatcttgcttgcaatcatagcgacagagaaactctgacttcagagactactgaaatccagagtatagtgattccatttattggacctataaacatgaagaaaggcgggcctcgtggaactctacatgagttttgcaagaagcatctgtggccaatgcctactttcgatacctcggaagagaaatccagaactccgtttgaattcatagatggcggtgagaagcggactagcttcagcagtttcacatcgaccataaccctaaggatacccaatcgtgaggctgtgatgtatgctggagaagcaaggcctgacaagaagagttccttcgactctgcagtcgtggaattgctttatgagctcgagcgccgcaagatcgtcataatacaaaagtag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]