LOCUS       NM_001160962             438 bp    mRNA    linear   PLN 20-OCT-2022
DEFINITION  Arabidopsis thaliana Toll-Interleukin-Resistance (TIR) domain
            family protein (AT1G57850), partial mRNA.
ACCESSION   NM_001160962
VERSION     NM_001160962.1
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 438)
  AUTHORS   Theologis,A., Ecker,J.R., Palm,C.J., Federspiel,N.A., Kaul,S.,
            White,O., Alonso,J., Altafi,H., Araujo,R., Bowman,C.L.,
            Brooks,S.Y., Buehler,E., Chan,A., Chao,Q., Chen,H., Cheuk,R.F.,
            Chin,C.W., Chung,M.K., Conn,L., Conway,A.B., Conway,A.R.,
            Creasy,T.H., Dewar,K., Dunn,P., Etgu,P., Feldblyum,T.V., Feng,J.,
            Fong,B., Fujii,C.Y., Gill,J.E., Goldsmith,A.D., Haas,B.,
            Hansen,N.F., Hughes,B., Huizar,L., Hunter,J.L., Jenkins,J.,
            Johnson-Hopson,C., Khan,S., Khaykin,E., Kim,C.J., Koo,H.L.,
            Kremenetskaia,I., Kurtz,D.B., Kwan,A., Lam,B., Langin-Hooper,S.,
            Lee,A., Lee,J.M., Lenz,C.A., Li,J.H., Li,Y., Lin,X., Liu,S.X.,
            Liu,Z.A., Luros,J.S., Maiti,R., Marziali,A., Militscher,J.,
            Miranda,M., Nguyen,M., Nierman,W.C., Osborne,B.I., Pai,G.,
            Peterson,J., Pham,P.K., Rizzo,M., Rooney,T., Rowley,D., Sakano,H.,
            Salzberg,S.L., Schwartz,J.R., Shinn,P., Southwick,A.M., Sun,H.,
            Tallon,L.J., Tambunga,G., Toriumi,M.J., Town,C.D., Utterback,T.,
            Van Aken,S., Vaysberg,M., Vysotskaia,V.S., Walker,M., Wu,D., Yu,G.,
            Fraser,C.M., Venter,J.C. and Davis,R.W.
  TITLE     Sequence and analysis of chromosome 1 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 408 (6814), 816-820 (2000)
   PUBMED   11130712
REFERENCE   2  (bases 1 to 438)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (19-OCT-2022) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 438)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-JUL-2017) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 438)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   5  (bases 1 to 438)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003070).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..438
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="1"
                     /ecotype="Columbia"
     gene            <1..>438
                     /locus_tag="AT1G57850"
                     /gene_synonym="F12K22.22; F12K22_22"
                     /db_xref="Araport:AT1G57850"
                     /db_xref="GeneID:842160"
                     /db_xref="TAIR:AT1G57850"
     CDS             1..438
                     /locus_tag="AT1G57850"
                     /gene_synonym="F12K22.22; F12K22_22"
                     /note="Toll-Interleukin-Resistance (TIR) domain family
                     protein; FUNCTIONS IN: transmembrane receptor activity;
                     INVOLVED IN: signal transduction, defense response, innate
                     immune response; LOCATED IN: intrinsic to membrane;
                     EXPRESSED IN: leaf lamina base, leaf whorl, leaf;
                     EXPRESSED DURING: LP.06 six leaves visible, LP.10 ten
                     leaves visible, LP.02 two leaves visible, LP.08 eight
                     leaves visible, LP.12 twelve leaves visible; CONTAINS
                     InterPro DOMAIN/s: Toll-Interleukin receptor
                     (InterPro:IPR000157); BEST Arabidopsis thaliana protein
                     match is: Toll-Interleukin-Resistance (TIR) domain family
                     protein (TAIR:AT2G03300.1); Has 1638 Blast hits to 1578
                     proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa
                     - 0; Fungi - 0; Plants - 1638; Viruses - 0; Other
                     Eukaryotes - 0 (source: NCBI BLink)."
                     /codon_start=1
                     /product="Toll-Interleukin-Resistance (TIR) domain family
                     protein"
                     /protein_id="NP_001154434.1"
                     /db_xref="Araport:AT1G57850"
                     /db_xref="GeneID:842160"
                     /db_xref="TAIR:AT1G57850"
                     /translation="

MEQGKKSERSMKKKQRRRWKKREKTREDVNKDKDELRGKTMTNLFVRIKESKIALVIFSSRYAESSWCMDELVKMKKRADKGKLQVIPIFYKVRARDVRGQTGEFGETFWALARTSRGDQIMEWKEALECISNKMGLSLGDKRYS"

     misc_feature    <94..399
                     /locus_tag="AT1G57850"
                     /gene_synonym="F12K22.22; F12K22_22"
                     /note="TIR domain; Region: TIR; pfam01582"
                     /db_xref="CDD:396246"
ORIGIN      

atggagcaaggaaaaaaatcagaaagatctatgaagaagaagcaacgaagaagatggaagaagagagagaaaactagagaagatgtaaacaaggacaaagacgagctaaggggaaaaaccatgacaaacctttttgtaaggattaaagagtcgaagatcgcactagttatcttctctagtaggtatgcggagtcgagttggtgcatggatgagctggtgaagatgaagaaacgtgcggataaaggaaagctccaagtcattcccatcttctacaaggttagggcaagagatgtgagaggacagaccggtgagtttggtgaaacgttttgggcgcttgcaagaacttctcgaggagatcagatcatggagtggaaggaagcgctagagtgtatttccaacaagatgggcctgtccttgggagacaaaaggtactcctag

//