2024-05-02 04:04:03, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001160962 438 bp mRNA linear PLN 20-OCT-2022 DEFINITION Arabidopsis thaliana Toll-Interleukin-Resistance (TIR) domain family protein (AT1G57850), partial mRNA. ACCESSION NM_001160962 VERSION NM_001160962.1 DBLINK BioProject: PRJNA116 BioSample: SAMN03081427 KEYWORDS RefSeq. SOURCE Arabidopsis thaliana (thale cress) ORGANISM Arabidopsis thaliana Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Camelineae; Arabidopsis. REFERENCE 1 (bases 1 to 438) AUTHORS Theologis,A., Ecker,J.R., Palm,C.J., Federspiel,N.A., Kaul,S., White,O., Alonso,J., Altafi,H., Araujo,R., Bowman,C.L., Brooks,S.Y., Buehler,E., Chan,A., Chao,Q., Chen,H., Cheuk,R.F., Chin,C.W., Chung,M.K., Conn,L., Conway,A.B., Conway,A.R., Creasy,T.H., Dewar,K., Dunn,P., Etgu,P., Feldblyum,T.V., Feng,J., Fong,B., Fujii,C.Y., Gill,J.E., Goldsmith,A.D., Haas,B., Hansen,N.F., Hughes,B., Huizar,L., Hunter,J.L., Jenkins,J., Johnson-Hopson,C., Khan,S., Khaykin,E., Kim,C.J., Koo,H.L., Kremenetskaia,I., Kurtz,D.B., Kwan,A., Lam,B., Langin-Hooper,S., Lee,A., Lee,J.M., Lenz,C.A., Li,J.H., Li,Y., Lin,X., Liu,S.X., Liu,Z.A., Luros,J.S., Maiti,R., Marziali,A., Militscher,J., Miranda,M., Nguyen,M., Nierman,W.C., Osborne,B.I., Pai,G., Peterson,J., Pham,P.K., Rizzo,M., Rooney,T., Rowley,D., Sakano,H., Salzberg,S.L., Schwartz,J.R., Shinn,P., Southwick,A.M., Sun,H., Tallon,L.J., Tambunga,G., Toriumi,M.J., Town,C.D., Utterback,T., Van Aken,S., Vaysberg,M., Vysotskaia,V.S., Walker,M., Wu,D., Yu,G., Fraser,C.M., Venter,J.C. and Davis,R.W. TITLE Sequence and analysis of chromosome 1 of the plant Arabidopsis thaliana JOURNAL Nature 408 (6814), 816-820 (2000) PUBMED 11130712 REFERENCE 2 (bases 1 to 438) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (19-OCT-2022) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 438) AUTHORS Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M., Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R., Vaughn,M. and Town,C.D. TITLE Direct Submission JOURNAL Submitted (18-JUL-2017) Plant Genomics, J. Craig Venter Institute, 9704 Medical Center Dr, Rockville, MD 20850, USA REMARK Protein update by submitter REFERENCE 4 (bases 1 to 438) AUTHORS Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M., Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R., Vaughn,M. and Town,C.D. TITLE Direct Submission JOURNAL Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute, 9704 Medical Center Dr, Rockville, MD 20850, USA REMARK Protein update by submitter REFERENCE 5 (bases 1 to 438) AUTHORS Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E. CONSRTM TAIR TITLE Direct Submission JOURNAL Submitted (18-FEB-2011) Department of Plant Biology, Carnegie Institution, 260 Panama Street, Stanford, CA, USA COMMENT REVIEWED REFSEQ: This record has been curated by TAIR and Araport. This record is derived from an annotated genomic sequence (NC_003070). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..438 /organism="Arabidopsis thaliana" /mol_type="mRNA" /db_xref="taxon:3702" /chromosome="1" /ecotype="Columbia" gene <1..>438 /locus_tag="AT1G57850" /gene_synonym="F12K22.22; F12K22_22" /db_xref="Araport:AT1G57850" /db_xref="GeneID:842160" /db_xref="TAIR:AT1G57850" CDS 1..438 /locus_tag="AT1G57850" /gene_synonym="F12K22.22; F12K22_22" /note="Toll-Interleukin-Resistance (TIR) domain family protein; FUNCTIONS IN: transmembrane receptor activity; INVOLVED IN: signal transduction, defense response, innate immune response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: leaf lamina base, leaf whorl, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.10 ten leaves visible, LP.02 two leaves visible, LP.08 eight leaves visible, LP.12 twelve leaves visible; CONTAINS InterPro DOMAIN/s: Toll-Interleukin receptor (InterPro:IPR000157); BEST Arabidopsis thaliana protein match is: Toll-Interleukin-Resistance (TIR) domain family protein (TAIR:AT2G03300.1); Has 1638 Blast hits to 1578 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1638; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink)." /codon_start=1 /product="Toll-Interleukin-Resistance (TIR) domain family protein" /protein_id="NP_001154434.1" /db_xref="Araport:AT1G57850" /db_xref="GeneID:842160" /db_xref="TAIR:AT1G57850" /translation="
MEQGKKSERSMKKKQRRRWKKREKTREDVNKDKDELRGKTMTNLFVRIKESKIALVIFSSRYAESSWCMDELVKMKKRADKGKLQVIPIFYKVRARDVRGQTGEFGETFWALARTSRGDQIMEWKEALECISNKMGLSLGDKRYS"
misc_feature <94..399 /locus_tag="AT1G57850" /gene_synonym="F12K22.22; F12K22_22" /note="TIR domain; Region: TIR; pfam01582" /db_xref="CDD:396246" ORIGIN
atggagcaaggaaaaaaatcagaaagatctatgaagaagaagcaacgaagaagatggaagaagagagagaaaactagagaagatgtaaacaaggacaaagacgagctaaggggaaaaaccatgacaaacctttttgtaaggattaaagagtcgaagatcgcactagttatcttctctagtaggtatgcggagtcgagttggtgcatggatgagctggtgaagatgaagaaacgtgcggataaaggaaagctccaagtcattcccatcttctacaaggttagggcaagagatgtgagaggacagaccggtgagtttggtgaaacgttttgggcgcttgcaagaacttctcgaggagatcagatcatggagtggaaggaagcgctagagtgtatttccaacaagatgggcctgtccttgggagacaaaaggtactcctag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]