GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 09:56:24, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XR_947942                366 bp    RNA     linear   PRI 02-MAR-2020
DEFINITION  PREDICTED: Homo sapiens uncharacterized LOC105369453
            (LOC105369453), ncRNA.
ACCESSION   XR_947942
VERSION     XR_947942.2
DBLINK      BioProject: PRJNA168
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000011.10) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jun 6, 2016 this sequence version replaced XR_947942.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Homo sapiens Updated Annotation
                                           Release 109.20200228
            Annotation Version          :: 109.20200228
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..366
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="11"
     gene            1..366
                     /gene="LOC105369453"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 1 sample
                     with support for all annotated introns"
                     /db_xref="GeneID:105369453"
     ncRNA           1..366
                     /ncRNA_class="lncRNA"
                     /gene="LOC105369453"
                     /product="uncharacterized LOC105369453"
                     /db_xref="GeneID:105369453"
     variation       2
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528755868"
     variation       22..28
                     /gene="LOC105369453"
                     /replace="aca"
                     /replace="acaaaca"
                     /db_xref="dbSNP:760668772"
     variation       34
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931384727"
     variation       48
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1223138581"
     variation       53
                     /gene="LOC105369453"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1343712534"
     variation       56
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270790802"
     variation       61
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1053307798"
     variation       71
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:892007412"
     variation       74
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1011829085"
     variation       76
                     /gene="LOC105369453"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1048505474"
     variation       77
                     /gene="LOC105369453"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:889770027"
     variation       86
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:556175858"
     variation       99
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1285706854"
     variation       103
                     /gene="LOC105369453"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:574604342"
     variation       108
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1487540222"
     variation       109
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:899816331"
     variation       110
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1202185124"
     variation       111
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1341924195"
     variation       112
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781615170"
     variation       113
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746390139"
     variation       119
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:998081966"
     variation       121
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:568091753"
     variation       122
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029510430"
     variation       128
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537093959"
     variation       135
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:541911191"
     variation       137
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1022547376"
     variation       142
                     /gene="LOC105369453"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1316728454"
     variation       152
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275810476"
     variation       154
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051168879"
     variation       155
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770099877"
     variation       157
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1346023452"
     variation       160
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1322836202"
     variation       170
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1384798844"
     variation       181
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:903403650"
     variation       183
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168699701"
     variation       184
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1158293037"
     variation       185
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967858872"
     variation       189
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:998943614"
     variation       191
                     /gene="LOC105369453"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:980916789"
     variation       193
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1033541774"
     variation       204
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480818738"
     variation       209
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:957493548"
     variation       211
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358371775"
     variation       219
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:561537493"
     variation       223
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764042512"
     variation       229
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1472945594"
     variation       234
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051324562"
     variation       236
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1184722087"
     variation       241
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:991786491"
     variation       242
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189961692"
     variation       247
                     /gene="LOC105369453"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:903349873"
     variation       249
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1286570753"
     variation       255
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1215886887"
     variation       256
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:552334470"
     variation       260
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918925534"
     variation       265..266
                     /gene="LOC105369453"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1293730206"
     variation       271
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:951642248"
     variation       278
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:983424090"
     variation       300
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468145430"
     variation       307
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1392964153"
     variation       316
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1207306144"
     variation       321
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1043928820"
     variation       322
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759519896"
     variation       332
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565280887"
     variation       334
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142130950"
     variation       336..337
                     /gene="LOC105369453"
                     /replace="ga"
                     /replace="gaga"
                     /db_xref="dbSNP:1368960170"
     variation       340
                     /gene="LOC105369453"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1449315698"
     variation       343
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309649171"
     variation       344
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234361570"
     variation       346
                     /gene="LOC105369453"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:534693653"
     variation       352
                     /gene="LOC105369453"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:938078521"
     variation       358
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1055127066"
     variation       360
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192799983"
     variation       366
                     /gene="LOC105369453"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:966128864"
ORIGIN      
cttggatttgggccaatttggacaaacagagttgggatagtaaacattccaagaagagaacaggataaacagaactgcagtaaggccccaagaagattggttggtgcccacccatatggagggcagatcttccaccctcagttcactaagattcacatgcaaatcacctctggaatcatcctcacagacatactaaaaaataatgttttaccagatttccagcctattcaccatgaagatgatgaagatgaaaatatttatgatggctctacttccacttagtgaatgatttagatcaaattctgcctttgaaaacttcacctttttatctacatgaaagatggggacagatgtttccaatgctta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]