GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-25 14:31:43, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       XR_593162               3761 bp    RNA     linear   ROD 26-JUL-2016
DEFINITION  PREDICTED: Rattus norvegicus NRDE-2, necessary for RNA
            interference, domain containing (Nrde2), transcript variant X3,
            misc_RNA.
ACCESSION   XR_593162
VERSION     XR_593162.2
DBLINK      BioProject: PRJNA12455
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_005105.4) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jul 26, 2016 this sequence version replaced XR_593162.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Rattus norvegicus Annotation Release
                                           106
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3761
                     /organism="Rattus norvegicus"
                     /mol_type="transcribed RNA"
                     /strain="mixed"
                     /db_xref="taxon:10116"
                     /chromosome="6"
                     /sex="pooled males and females"
                     /note="pooled female animals of strain BN/SsNHsdMCW plus
                     one male of strain SHR (also known as SHR-Akr)"
     gene            1..3761
                     /gene="Nrde2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 ESTs, and 100% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     78 samples with support for all annotated introns"
                     /db_xref="GeneID:314381"
                     /db_xref="RGD:1565082"
     misc_RNA        1..3761
                     /gene="Nrde2"
                     /product="NRDE-2, necessary for RNA interference, domain
                     containing, transcript variant X3"
                     /db_xref="GeneID:314381"
                     /db_xref="RGD:1565082"
ORIGIN      
tttcactggagcaccagggcacaaggaaacagctctttcccggcctcacttttttcccctcctcccctctctaccctttgggtctcggcaccacctaacccagggttaagccccatcgggtgctcagaactacatttcccagagggcttcgcgagtcagcgtcctccaatcagagctctccagacggcgccatttctgtggcggaagtggtggtgcggcctgtgatcatggcgctgttcccggccttcgcgggcgtaagtgaggcctccggtgatggagcatccaggaaagagttagactggctgagcaacccaagctttcgtgttggaaatctcacgtctctgagccgacaaactgaagaggtcccggcccttgcttctgaagcgtcaccactgacaaggagtccgttgaagtcagagctctcagatgagagtgacactaatgagaagctcacacagataagcaagaaaaagaagaaagagaaaaagaagaaaaggaaacaccagcaccacaagaaaaccaagaggagacacgagcagtcgagcagcagtgggtccgggtcagacacagaggctgggaaggacagggcttcccgaagtatcagggatagccaagagtctgagaaagcccgtcaaggaagtaatgctgttcctgctgctcctgctactggacatagctccatttggctggaagatatttacactctgacagacgtcttcaggacagataagaaaccagatcctgccaactgggagtataaatctctgtatcgtggggatatagcaaggtacaagaggaagggagactcctgcctgggtatcaaccctaagaagcagtgtatatcttgggaaggggcttctgcagcaaagaagcactcacacagacacctggagcgctattttaccaagaagaatgtggcattgttacgaactgaggggattgccgtgtgcagtaaccctgagccctcctcctctgagccagccccattcatcccagtgaaggactctgccgatgtggctactcctgttacaacatggctgaatcctctgggcatttatgatcagtctaccacacagtggttacaagggcagggtccagcagagccagagttaaagcagccagactcacagcaggagagggacagtgctgctcttaaggccagagtggaagagtttaacaggagagttcgggaaaaccctcgggacacgcagctatggatggcattcgtggctttccaggatgaagtcatgaggagtcctggcatctatgctcttggggaaggagagcaggagaagcacaggaagtccctgaagctcctcctggagaagaagctggctgtactggagcgggccatcgagagcaacccaagcagcgtggagctgaagctcgccaagttgcagctgtgctcagaattctgggagcctagtgcgctgaccaaggagtggcagaagctcctcttcctgcaccccaacaacacaagcctgtggcagcgctatctctccttttgccagagtcagtttggcaccttttctgtgtccaaactccacagtctatatggcaagtgcttgagtaccttgtctgctgttaaagacggcagcatgttatcccaccctgtgttgccgggcactgaggaggccatgtttgggctctttcttcagcagtgccactttctacggcaggctggccactcggagaaggtcgtctctctgttccaggccatggttgacttcaccttcttcaagcctgacagtgtgaaagagctgcccacaaaagtgcaggtggaattctttgaacccttctgggacagcggagagccccgtgttggggagaagggagcccgaggctggcgggcgtggatgcaccagcaggagcgtggtggctgggtgcttgtcaacccagatgaggatgacgaggagccggaagaagaggaccaagagataaaagacaagaccctgcccaggtggcagatctggcttgctatggaacgttctcgagaccagaggcactggcgtccctggcgccctgataagaccaagaagcaaacggaggaagactgtgaggaccccgagagacaggtgctgtttgatgacgttgggcaatctttgatcagactttccagcccagatcttcagttccagctcattgaggcctttctgcagttcctgggtgtaccttctggcttccttcccccagcctcctgcctttatctggccatggacgagagtagcatctttgagagtaaactttatgatgaaaagcccttgacttacttcaaccctttattttctggcattagctgtgtgggctacatggaacagttggattgtcctcgctggaccaaaggtcacaaccgagagggcgaggagtttgtccgcaatgtcttccacctggtgctgcctctgttctcaggcaagcagaagtgccagctctgcctctcttggttacggtacgagattgccaaggtcatttggtgtctacacactaaaaagaagagattgaagtctcagggaaagaactgcaaaaagctagccaagagtctcctcaaggagccagaaaaccgcaacaacctctgcctctggaggcagtatgcacacctggagtggttgctcggcaacacagaggatgccagaaaggtgttggatgcagccctcagcatggcaggcagcagcgacctgaaggaccgggagctctgtgagctcagtctgctctatgctgagctggaggtagagctgtctcctgactcgagaggagccaccacaggccgtgccgtccacgtactaactcggctgacggagagcagcccctgtgggccctacactgggcaggtctcgtccactcaggttctgaaagcccggaaggcttatgagcatgcgctgcaggactgtctgggacagagctgtgcctccagcccacctactgcagagtcgttggactgcctgggtagcctggtcaaatgcttcatgctcttccagtatttgactgtaggaattgacgctgctgtgcaggtgtacagacaggtgttttccaagctggagggctctgctctcctggaaggcccggggccagaggacagtgccagctcccagagtgtgaccagtgttctcgaggccgtcaccctgatgcacacaagcctgctgcgattccacatgaacatttgtgtgtaccctctggctccactccgagagaccctctcagacgctttaaagctgtatccaggcaaccagggtctttggagggcttacgtgcagattcagaataagtcccacagtgctaacaagaccagaagattctttgacacagtcactaggtctgccaagcatttggagccttggctgtttgcaatcgaagctgagaagctgaggaaaaggctggtggaatctgttcagaggtaattagtgacagtctcctgcatgggcttcacagacctttatgggatggttgccatgttcgcaggcccggccaccctggtacgactgctctagttgtgtccagtacagactgaagagtgagtaagaccctgaggaagtgcctccatcctccttcctgcgccaggcttccacctgactggtttctggtgtctgaggagctgtaatgagagcattgtgctgtcaagtgtagactgtagaggctctggtgccagtacctgctctgccacttgtcacctcaaccttggggtaggtggcagggaggtccatgctacaatccccgagactggtcttacgcatcggatcagagctttgtttgaaaatgcaatccggagc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]