GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-26 15:33:11, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       XR_519398               4014 bp    RNA     linear   MAM 23-JUN-2016
DEFINITION  PREDICTED: Oryctolagus cuniculus NRDE-2, necessary for RNA
            interference, domain containing (NRDE2), transcript variant X2,
            misc_RNA.
ACCESSION   XR_519398
VERSION     XR_519398.2
DBLINK      BioProject: PRJNA42933
KEYWORDS    RefSeq.
SOURCE      Oryctolagus cuniculus (rabbit)
  ORGANISM  Oryctolagus cuniculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Lagomorpha;
            Leporidae; Oryctolagus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_013688.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jun 23, 2016 this sequence version replaced XR_519398.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Oryctolagus cuniculus Annotation
                                           Release 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4014
                     /organism="Oryctolagus cuniculus"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9986"
                     /chromosome="20"
                     /sex="female"
                     /breed="Thorbecke inbred"
     gene            1..4014
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 EST, 8 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 12 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:100350352"
     misc_RNA        1..4014
                     /gene="NRDE2"
                     /product="NRDE-2, necessary for RNA interference, domain
                     containing, transcript variant X2"
                     /db_xref="GeneID:100350352"
ORIGIN      
gtctgaggtcaagccccagcccgcacgagggaaaccacgcttcccagcatacaccgcgacggcggaggcttcaaaccggcgcttggccgccgccgccatttctgtagaggggaacggcggagaaagctgcgttgatggcgctgttcccggcctttgcgggcgtgagtgaggcccccgatggtgggagctcccggaaagaattagactggctgagcaaccctagcttttgtgttggaagcctgccgtcgctgagccaccaaactgaggagcccacggccctggtttctgaaggggcaccactgccaaggagttctctgaaatcagaacctgcagatgaaagtgacaccgaccagaagctcatccaaacgagcagaaaaaagaagaaagagaggaagaagaagaggaagcatcagcatcacaggaagacaaagagaagacgcgggcagtctggcagcagcgagtctgcgccggacactgattctgccgaggacgggccctccaggggcagcaggagggcctccgagaaaccaggtccaggaagtaactctgctgccgagactgggcgtcgccttgtttggcttgaggatgtccaggctgtgactggagaaaccttcagaacagataagaagcctgatcctgccaactgggagtataagtctctctaccgcggggatatagcaagatacaggaggaaaggagattcctgccttggcataaaccccaagaaacagtgtatttcttgggaaggggcttccacagaaaagaagcggacccgtaagcatgttgaacgctattttacaaagaagagtgtgggattgatgaacatcgatggcgtcgccattaccagtaaaactgcatctccctccgctgagccaggcccctttatcccagtgagggactcggacgatgtgactgctcctgttgcaacctggctgaatcctctaggggtttatgatcagtcaaccacacagtggttacaaggacagggtccttcagagcaagagtcaaagcagcctgactcacaggcagacagagagaatgctgctctcaaggccaagggcgaggagtttaacaggaaagttcgggagaatccttgggatactcagctgtggatggcatttgttgcttttcaggatgaggtcatgcggtgtcctggcctgtacaccatcgaggacggcgagcgggagaagcggaagaagtccctgaggctgctcttggagaagaagctggctgtcctggagcgggccgtcgagagcaacccgagcagcgtggagctgaagctcgccaagctgcagctgtgtgccgagttctgggagccctccgctctgctcaaagagtggcagaaactgatttttttacaccctaataatacagccctttggcagaaataccttttattttgccagagccagtttagcaccttctcagtatcaaagattcacagtctgtatggaaagtgcctgagtactttgtcggctgtgaaggacggcagcgtcttgtctcaccccgcgctgcctggcacggaagaggcgatgtttgggctctttcttcagcagtgccactttctgcggcaggctggccactcggagaaggccgtctctttgttccaggccatgattgacttcactttcttcaaacccgacagcgtgagagatctgccgaccaaagtgcaggtggaattctttgagcccttctgggatagtggagagccccgggctggggagaagggagcccggggctggagagcgtggatgcaccagcaggagcgcggtggctgggtggtcatcaacccagatgaggatgatgatgagccggaagaggacgaccaggagataaaggataagactctgcccaggtggcgaatctggcttgctgctgagcgttcccgagaccacaggcattggcggccctggcgccctgataagagcaagaagcagacagaggacgactgtgaggatcctgagagacaggtgctgtttgatgacgttggacagtctctcatcagactctgcagacccgatcttcagttccgactcgtcgaggcctttctgcaggtcctgggcgtgccttctggcttcacacctcccgcctcctgcctttacctggctatggacgagaatagcatctttgataatggactttatgatgaaaagcccttgacgtccctcagccctttgttttctggtgtcagcagcgttggccggatggacccgctgggctgtcggcggtggaccaggggtcacggtcgggagggcgaggacttcatccgcaacatcttccaccttgtgatgcctttgttttcaggcaaggaaaagtctcagctctgcttctcctggctgcagtacgagattgccaaggtcatttggtgtcttcacactaaaaataagaagagattaaaatcacaggggaaaaactgcaaaaaactagcaaagaatctccttaaggagccagaaaaccgcaacaacttttgcctctggaagcagtatgcgcatctggagtggttgcttggcaacaccgaggactccaggaaagttttcgatacggcgctcagcctggtgggaagcagagacctgaaggaccatgaactctgtgagcttagtctgctctatgcccaactggaggtggagacagagctgtcgccagactccacggggtccgccacggcccgagctgtccacgtattaacccgactgaccgagagcagtccctacgcgccctacacggggcaggtgttggctgtgcacattctgaaggcccggaaggcttacgagcacgcgctgcaggacagcctgagtgagagctgtggccccactccagcgcctgtcccttccgttagctgcctgatcagcttggtcagatgctttatgctcttccagtatttgactgtagggattgacgctgccgtgcgggtgtatgagcaggtgtttgccagactgaaggagtgtgttttcccggaaggctctggcctggaggacagagcgggctccccgagtctgagcagagtcctcgaagcggtcaccctgatgcacacgactctgctgcagttccacatgagagtcagcgtttaccctctggctcctctgcgagaggcgctctcagaggctttacagctgtatcctggcaaccaggtcctttggaggttatacgtgcaggtgcaaaataagtcccacagtgccagcaagactagaagattcttcgctgcaatcaccaggtctgccaaacccttggagccttggctgtttgcaattgaagctgagaagatgaggcgaaggctggtggagacggtccagagggtaggtggtggagaggtccactgcacgattcccgagactggcctgacgcaccggatcacggccctgttcgagaatgcgctgcggcgtgaagatggcagccagtgccccctactgtggaggatgtatttgaactttttggtctccctaggaaacacagacagaagtaaaggtgtgttctacagagcgcttcagaagtgcccgtgggcaaaggccttgtacctggacgctgtggagtacttccccgatgccatgcaggaggtgctggacctcatgaccgagaaggagctgcgcgtgcgcctgccgctggaggagcttgagctcctgctggagggctgcgtgtagaggagcaggtgtggcctctgtcttcagaacagcgcgctggagggtcctggcctgtggcaggtgcgtggaacagttctcattgatccctgagctgcacttggtgacgctgacctctggggaccagcagtgccgccgggaggagcagtgcacgctgtctgcccgtcccagctgtgctcaatcaggatccgccctgacagggaaaagcagcaattcctgaacctgaatgagggagtattatgggaaagaaaagatgaaaatgtaaggctggaattcaaaggcccacatcgcacagacctcaggtggacctgtttttggtaaattacagtattggctcaatgctcattttacaaagcacacttagcacacatgagacaaaacc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]