GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-25 14:28:18, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       XR_450886               3660 bp    RNA     linear   MAM 17-MAR-2014
DEFINITION  PREDICTED: Balaenoptera acutorostrata scammoni NRDE-2, necessary
            for RNA interference, domain containing (NRDE2), transcript variant
            X2, misc_RNA.
ACCESSION   XR_450886
VERSION     XR_450886.1
DBLINK      BioProject: PRJNA237330
KEYWORDS    RefSeq.
SOURCE      Balaenoptera acutorostrata scammoni
  ORGANISM  Balaenoptera acutorostrata scammoni
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Cetartiodactyla; Cetacea;
            Mysticeti; Balaenopteridae; Balaenoptera.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_006726810.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
FEATURES             Location/Qualifiers
     source          1..3660
                     /organism="Balaenoptera acutorostrata scammoni"
                     /mol_type="transcribed RNA"
                     /sub_species="scammoni"
                     /db_xref="taxon:310752"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="muscle"
                     /country="South Korea"
                     /collection_date="16-Feb-2011"
     gene            1..3660
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 8 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 2 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:103002567"
     misc_RNA        1..3660
                     /gene="NRDE2"
                     /product="NRDE-2, necessary for RNA interference, domain
                     containing, transcript variant X2"
                     /db_xref="GeneID:103002567"
ORIGIN      
cggtgcggcctgtgatcatggcgctgttccccgcctttgcgagtgttagtgaggcgcccgagagtgggagccccaggaaagaattagactggctgagcaacccaagcttttgtgttggaaccgtaacatctctgggccaacaaactgaagaggccacagcctttgtttctgaagagtcgctactgaccaggagtcctctgaattcagagccttcagatgaaagtgacactaacagaaagcccaaacaaacaagcagaaaaaagaagaaagagaaaaagaagaaaaggaagcatcagcaccacaagaaaaccaagagaaatcgtgggcagtcaagtagcagtggctctgagtcatatactgattctgaaaaggacagatcttccagaagcatcagagacagtaaaaaggaatcagagaaaccgaatcaagaaaataatgccactgctgatattggacgtcactttgtttggcttgaggacattcaggctctgatgggagaaaccttcagaacagataagaagccggatcctgcaaactgggagtataagtctctttaccgaggagatgtagcaagatacaagaggaaaggacactcctgccttggcattaaccctaagaagcagtgtatatcttgggaggggacgtccacagaaaagaagcggtcacacaagcatgtcgagcgctactttacaaagaagagtgtgggattaatgaacattgacggagttgccattagcagtaaaactgagcctgcctcatcggagtcgatctcatttatcccagtgaagggtgcagaggacgtggttgcccctgttacaacctggttgaaccctctggggatttatgatgaagccaccacgcagtggttacaaggccggggtccttcagagcaagcatccaagcagccagattcacagcccaacagggaggacgtgcttctcaaggccaaggtggaggagtttaacaggagggtatgggagaatcctcgggatgttcagctgtggatggcatttgttgcttttcaggacgaggtcatgagaagtccgggcctgtatgccattgaggaaggagagcaggaaaagcggaagcggtccctgaggctggttctggagaagaagctggccattctggaacgggccgtggaaagcaacccgagcagcgtggatctgaaactcgccaagctgcagctctgcaccgagttctgggagccctccactctggtcaaagagtggcagaaactgatatttttacatcccaacaatacagccctttggcagaaataccttttattttgccagagccagtttagcaccttttccatatcaaaaattcagagtctttatggaaaatgcttgagtactttgtctgctgttaaggacggcagcatcttgtcccaccctgagctgcctggcaccgaggaggccatgtttgccctctttcttcaacagtgccactttctgcggcaggctggtcactccgagaaggccgtctctctgttccaggccatggttgacttcaccttcttcaaacccgacagtgtgaaagacctgcctaccaaaggacaggtagaattctttgagcccttttgggacagtggagagcccagggctggggagaagggcgcccgaggctggagagcgtggatgcaccagcaggagcggggcggctgggtggtcgtcagcccagatgatgacgatgatgaaccggaagacgacgaccaggaaattaaagataagactctgtccaggtggcagatctggcttgctgctgagcggtcccgagaccacagacactggcggccgtggcgccctgagaagaccaagacgcaggcggaggaagactgtgaggacccagagagacaggtattgtttgatgatattggacagtctctgatccaactttccagcccggatcttcagtttcagctggttgcagcctttctgcagttcttgggtgtgccttccggcttcagccctccggcctcctgcctctatctggccatggatgagaacagcatctttgacaatggactctatgatgaaaagcccttgacttttctcaacctttcattttccggcgtcagctgtgtgggacgcacagaccagctgggttgccggcactggaccaggggtcacagtcgagagggcgaggagttcgtccgcagcatcttccacctcgtgatgcctttgttttcaggcaaggagaggtctcagctctgcttctcctggttacagtacgagattgcaaaggtcgtttggtgtctgcacactaaaaacaagaagagattaaaatcacaaggaaagaactgcaaaaaactagccaagaatctccttaaggagccagacaaccgcaacaatttttgcctctggaagcagtatgcgcatctggagtggctgctcggcaacacagaggatgccagaaaagttttcgatacagcactcagcatagcagggagcagagaactgaaggaccatgagctgtgtgagctcggtctcctctacgccgagctggaggtggagctgttgccggacgtgaggggggccgccccagcccgagccattcacgtattgaccagactgaccgagaatggggcctacgggccctacaccgggcaagtctcggccgttcacattttgaaagttcggaaggcttatgaacacgcgctgcaggactgtttgggggagagctgtgtctccgattcctttagccgcctgattagcctggttaaatgctttatgctcttccagtatttgaccctagggatcgacgctgctgtgcggatatatgagcaggtacttgcaaaacaccaggtctctgtttccgcagagggccctggtctggagggcagtgccagcccgcagagcctgagcagcgtcctcgaggccgtcaccctgacacacacgagcctgctcaggttccacatgaaagtcgccgtctacccgctggctcctctgcgagacgctctcacggaggctttaaagttgtatccgggcaaccaggctctttggaggtcatatgtacagattcagaataagtcccacagtgccagtaagaccagaagattcttcaatgcgatcaccaggtctgccaaacccttggagccgtggttgtttgcaattgaagctgagaaaatgaggaaaagactagtggaaactgtgcagagggtagacggtagagaggtccacgccaccattcccgagaccggcctgacgcatcggatcagagccctgtttgaaaatgcgatgcggagtgactacggcagccagtgccccttactgtggaggatgtatttgaattttttggtttccttaggaaataaagaaagaagcaaaggtgtgttctacaaagcacttcagaattgtccttgggcaaaggtgctgtacctggatgccgtggagtacttccccgatgagatgcaggagatcctggacctgatgacggagaaggagctccgggtgcgcctgccgctggaggagctggagcttctgcttgaggactagaggccaggaggggagtggggcatgcctccgaggcctcggcgcctgccccttgggagccaggagacaccagaagagacgctgctgttgaacaactgccaccagctctgggggtgtgacggggcagcaggtattgaagtctgcagtccttttggtcagccag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]