GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-23 03:03:42, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       XR_332023               3648 bp    RNA     linear   VRT 04-JUN-2018
DEFINITION  PREDICTED: Pelodiscus sinensis NRDE-2, necessary for RNA
            interference, domain containing (NRDE2), transcript variant X3,
            misc_RNA.
ACCESSION   XR_332023
VERSION     XR_332023.3
DBLINK      BioProject: PRJNA221645
KEYWORDS    RefSeq.
SOURCE      Pelodiscus sinensis (Chinese softshell turtle)
  ORGANISM  Pelodiscus sinensis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Testudines; Cryptodira; Trionychoidea; Trionychidae; Pelodiscus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_005854923.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jun 4, 2018 this sequence version replaced XR_332023.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Pelodiscus sinensis Annotation
                                           Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3648
                     /organism="Pelodiscus sinensis"
                     /mol_type="transcribed RNA"
                     /isolate="Daiwa-1"
                     /db_xref="taxon:13735"
                     /chromosome="Unknown"
                     /sex="female"
                     /country="Japan: Saga"
     gene            1..3648
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 31 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:102461156"
     misc_RNA        1..3648
                     /gene="NRDE2"
                     /product="NRDE-2, necessary for RNA interference, domain
                     containing, transcript variant X3"
                     /db_xref="GeneID:102461156"
ORIGIN      
tgctcgcgcgagccgcgccatcttgcctggctgggcgccggggcctccttgagaagcaagagggacggaagcggtggttcggcctatggctcttttcccagcctttgccggcgccgccgagcccggggagacgcccgctagcggtagcgagggctccaggagagaattgaactggcttagcaatccgagcttctgcacagaagatgcactaaaactgcaccagcatactacaaagactgtagatcttactgctgagagatcagaacttacaagcaggagtccttcaagagcagagctttcaggaggaagtgataccgatgaaggtctaaaaaaatcaattaagaaaagtaaatggaaaaagaaaaagcatcaccaccacaagaaaagaaaaaagaaaactagagatgaatcaagtaacagtgagtcagacttggatactgagtgtgtgaagggtaaacctcgaggaagtaacacaaaccctgaaagagaagtagcagcattaaatctagaagatataacatcaaatgttgccaccaatcgctttgtttggcttgaggatattcaggctttgacagcagaaaccttcagaacagacaagaaaccagaccctgcaaactgggaatacaagtcactatatcgtggcgacatagcaagatacaagaggaagggtgacttctgccttggtattgacctaaagaaacaacgtataacttgggaaggtcccatggtagaaaagaaacagtcccacaagcgacctgaacgctacttcacaaaaaacagtgtgcagttactgcgtgcaggtggaattccagtttacagtaaaagccaaacttattcatctgacccaagcacctttatattagtttcacaagtggacagcgatgctcctcctgcaacaaccagggtgaatcctctggggatttatgatccattgactactctgtggttgcaaggaaaaggtcccccagagtatgagacttcaaagcaacaggcatcccaagaaaccagtgaaaatgttaactcttttctaatggcaaaagtggaagactataataagagggtcagagaaaacccaagagatgtccacacttggatggaatttgtttcttttcaggatgaactaatgagaggacccagcctttatgccttcaaggagggagagcaggaaataaggagaaaatcattcaagctaatactagaaaagaaactgtcaattttagagagagctattgaaagcaacccaaatgaggttgatctgaagcttgccaagctgaacctttgtacagaattctgggaaccatcaactttgatcaaagaatggcagaaactggtttttttgcatcccaataatccagttttatggcagaaatatctcttattttgtcaaagtcagttcagtaccttttcagtttcaaaagtcaatagtttatatggaaaatgtttgagcactttggcagctatagaggacggcagtatggtatcacatcctgtactacctggcacagaagaagctatgttagctatctttcttcagcagtgccattttcttagacagacgggccattctgagaaagctgtgtctttgttccaagccctggttgatttcaccttctttaaacctgacaatgtaaaagatctgccaacaagaggacaggtggagttctttgaaccattttgggacagtggagagcctcggtttggagaaaaaggagcaaaaggctggaaatcatggatgcatcaacaagaaaagggaggctggattgttatcaataaacctgatgaagatgaggaagatgtagatgaagatccagaaataaaggataaaactctacccaaatggcaaatttggcttgacgttgaatgttcccgtgaaacaaggcattggatgccttggcgacctgacaaaactaaaaaacagagtgaagaagattgtgaagacccagagagacaggtattatttgatgatcttgggccatctttaatcagactttctagtccagatcttcagtttcagctgctatattcatttctacaatttttgggagtcccatgtgagcgtaatctctttccttcaaatctctatatcgctatggatgagaatagcatctttgatgctgggcattctgaagggccactgacttcttttgactcactgctttctggagtcaatagtattggccatatggatacaatgatcagagagagacagcgcataggacactgtaaggaaggagaggagttcctacagaatgtctttcatttcatactgccaatgttttcaggaaaggaaaagtcaaacctgtctgtctgttggctacaatatgaaatctcaaaggttgttcagtgtctccaagtgaaaaacaagaagaaactgaagtcacaggggaagaagagcaaaaaactagccaagaatctccttaaggaatctgaaaaccgaaacagcctttccctctggaaactgtatgcttacttggagtggttacttggcaacacagaagattctagaaaagtgtttgatacagctctttgtttggcgggaactgacgggatgagaagtacccaactctgtaatctgagcttgttttatgcttcactggaagtggagctgttagagagtctggaggaaactgttatgtcacgtgctgtacatatattgaccaaagtgactgaaagtggaccatatgtgccttatactgggcaggtgttatctgtgaatatcttgaaagctcggaaagcatatgagcatgcattgaaagattatttaaatgaaagccctgtcactaactgggatcaggccagtggttctagccaaatggttagtttagttggttgttatgcgcttttccagtatttgactgttgggattgatgctgctgtattcatatatagaaatatttctgaaaagcttaaagattttgcttcacagaagtttgaaagtattggagaaaatcttggcgttcagaattttcccactgcccttgaagctgtcacactcatgcacacaaatttactcaggtaccatatgaaagttagcatttatcctttaaatccactgcgagaggcactaatggaagctttgaagctgtatcctagcaaccagtctctttggagatcatatatccagatccaaagcaagtctcacaacgctagcaaagcacgaagattttttgatagcgtcgcaaggtctaccaagttcctagagccatggctgtttgcaatccaagccgagatgatgagaaagaagcttgttgagagtgtccaaagatgttggagaaatatattcaacaattcctgaaaccggattaacgaatcggatcaaagctttatttgaacatgcaattcagagtgaaaatggtgcccattgtccgttgctgtggagaatgtatttgaattttctgttttctctcggaaataaagaaaggagcaaaggactattttacaaagctcttcagaactgtccctgggcaaaggtgctgtatatggatgcaatagaatattttccagatcagctgcaagagatcctagatctaatgactgaaaaagaattgagaataagagtacctatagaagaactggaactgctactggaagattaaaagaagatggtgcaagaacaaaaaccaaaacaatacacaaagataagataag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]