GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-08-29 09:14:00, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       XR_012591672             363 bp    RNA     linear   VRT 25-JUN-2025
DEFINITION  PREDICTED: Sebastes fasciatus uncharacterized LOC141757574
            (LOC141757574), ncRNA.
ACCESSION   XR_012591672
VERSION     XR_012591672.1
DBLINK      BioProject: PRJNA1276069
KEYWORDS    RefSeq.
SOURCE      Sebastes fasciatus (Acadian redfish)
  ORGANISM  Sebastes fasciatus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Eupercaria; Perciformes; Scorpaenoidei;
            Sebastidae; Sebastinae; Sebastes.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_133796) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_043250625.1-RS_2025_06
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.4
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 06/12/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..363
                     /organism="Sebastes fasciatus"
                     /mol_type="transcribed RNA"
                     /isolate="fSebFas1"
                     /db_xref="taxon:394691"
                     /chromosome="2"
                     /sex="male"
                     /tissue_type="muscle"
                     /dev_stage="adult"
                     /geo_loc_name="Canada: Gulf of St. Lawrence"
                     /lat_lon="48.183022 N 61.151193 W"
                     /collection_date="2022-08"
                     /collected_by="Eric Parent"
     gene            1..363
                     /gene="LOC141757574"
                     /note="uncharacterized LOC141757574; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 94 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:141757574"
     ncRNA           1..363
                     /ncRNA_class="lncRNA"
                     /gene="LOC141757574"
                     /product="uncharacterized LOC141757574"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
                     /db_xref="GeneID:141757574"
ORIGIN      
agagacacgattatcttttggcagtttaggtttgtattagatcgcaccaagttaagagtgtatgttggttctgaaagccccttttctttctcacaatctcttcttgcagcttcctgaagagccgcagtgtgtgtgtgtgcgtgcaggcaggcactatcatgatctcctctgtttggttctggatgtagaagttccactgcagccaggtttttaaaaagaaatactgcagaattcagtaatttgcatgcaaatatccctctaaactaggaaagttcaattcatatttgtgaacatgtgctattctttttcacaccaaaatgtacaacatgagtttcaactcctgttacaatgttggaaacctga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]