GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-12-08 09:45:44, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       XR_011995229             242 bp    RNA     linear   MAM 01-APR-2025
DEFINITION  PREDICTED: Vulpes vulpes uncharacterized lncRNA (LOC140594440),
            ncRNA.
ACCESSION   XR_011995229
VERSION     XR_011995229.1
DBLINK      BioProject: PRJNA1241828
KEYWORDS    RefSeq.
SOURCE      Vulpes vulpes (red fox)
  ORGANISM  Vulpes vulpes
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia; Canidae;
            Vulpes.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_132790) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_048418805.1-RS_2025_03
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 03/26/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..242
                     /organism="Vulpes vulpes"
                     /mol_type="transcribed RNA"
                     /isolate="BD-2025"
                     /db_xref="taxon:9627"
                     /chromosome="11"
                     /sex="female"
                     /cell_line="fibroblast"
                     /tissue_type="cell line"
                     /dev_stage="adult"
                     /geo_loc_name="Russia: Novosibirsk"
                     /collection_date="2008"
     gene            1..242
                     /gene="LOC140594440"
                     /note="uncharacterized LOC140594440; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:140594440"
     ncRNA           1..242
                     /ncRNA_class="lncRNA"
                     /gene="LOC140594440"
                     /product="uncharacterized lncRNA"
                     /db_xref="GeneID:140594440"
ORIGIN      
cagggagcccgatgtggcactcgatcccgggactccaggatcacaccctgagccgaaggcagacgctcaaccactgagccaccaggcgtcccaattataaaaggttattaatttgaccatttaacctttctatcatcctattttttaaaaagctgaggtcatccatgtgctttctctgatgtgcctgttgcaagaagagattgattccagacaagtgaaacatacctgaagattctggcccg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]