GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-21 07:47:33, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       XR_011727899             404 bp    RNA     linear   VRT 03-MAR-2025
DEFINITION  PREDICTED: Heliangelus exortis uncharacterized lncRNA
            (LOC139800744), ncRNA.
ACCESSION   XR_011727899
VERSION     XR_011727899.1
DBLINK      BioProject: PRJNA1226279
KEYWORDS    RefSeq.
SOURCE      Heliangelus exortis
  ORGANISM  Heliangelus exortis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Neoaves; Strisores; Apodiformes;
            Trochilidae; Heliangelus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_092432) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_036169615.1-RS_2025_02
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 02/24/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..404
                     /organism="Heliangelus exortis"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:472823"
                     /chromosome="11"
     gene            1..404
                     /gene="LOC139800744"
                     /note="uncharacterized LOC139800744; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:139800744"
     ncRNA           1..404
                     /ncRNA_class="lncRNA"
                     /gene="LOC139800744"
                     /product="uncharacterized lncRNA"
                     /db_xref="GeneID:139800744"
ORIGIN      
ccttttgccccttggtatctttgttctcttaagaggagtgattgaatgctaatgaagcaaggagaaaccgtagctgccttcagtcttctatctcagctctgttctgcagcactgccagctgctctgggctgctctcatttccacaatccttagctggttaactgggacatgctgagagcagacagctctgacaaccttgctgctggagcctttctcttcattcaaaatttgtgcagctgggattctgatctggagagtcctttttgtaacctctgtgacagacatgagaggtgttgatctgcttagcttcaatctcttcttgaatggacaacaggtgtatgccttgtgaggagctgtgtgcacagctgggaaggtgcatagacatgaagcactgcatcaggcag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]