GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-02 17:57:35, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XR_010720623             415 bp    RNA     linear   VRT 01-JUL-2024
DEFINITION  PREDICTED: Chamaea fasciata uncharacterized lncRNA (LOC136288878),
            ncRNA.
ACCESSION   XR_010720623
VERSION     XR_010720623.1
DBLINK      BioProject: PRJNA1129162
KEYWORDS    RefSeq.
SOURCE      Chamaea fasciata
  ORGANISM  Chamaea fasciata
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Neoaves; Telluraves; Australaves;
            Passeriformes; Sylvioidea; Sylviidae; Sylviidae incertae sedis;
            Chamaea.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_027094089) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_029207755.1-RS_2024_06
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 06/28/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..415
                     /organism="Chamaea fasciata"
                     /mol_type="transcribed RNA"
                     /isolate="MVZ Bird 193981"
                     /specimen_voucher="MVZ:Bird:193981"
                     /db_xref="taxon:190680"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="liver"
                     /ecotype="frontalis"
                     /geo_loc_name="USA: Cow Mountain Recreation Management
                     Area, Mayacamas Mts., Lake Co., California"
                     /lat_lon="39.09208 N 123.08350 W"
                     /collection_date="2020-10-13"
                     /collected_by="Carla Cicero"
     gene            1..415
                     /gene="LOC136288878"
                     /note="uncharacterized LOC136288878; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:136288878"
     ncRNA           1..415
                     /ncRNA_class="lncRNA"
                     /gene="LOC136288878"
                     /product="uncharacterized lncRNA"
                     /db_xref="GeneID:136288878"
ORIGIN      
aaagacttgcagtggagaagtacaacatctgcagagtagagatcgctgaaaagaaattccacagtaaagaacgaactcaagcagaaaggacttgtcagatttctcagcacaagactgacactcagaatgaccttcagcacaagcaggaggatgcttttgagaaaatgtctgaacagtctaaaagcacaggaagattgccagcagaaagaaaagcaagaccttgaacagcagtactgacatctccttgcagaagttcacgcaagagcacaggaatgtgaagcgcaagcgcagaacaccaggcaaaaactgtgtgaccttgaacaaatctgcatggaaacggcccaggaatacaatgctgtgagaaatacatgatcagatgctcacaaggagcactcatctctgctggcagcctgtg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]