GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-02 17:57:35, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XR_010707750             325 bp    RNA     linear   INV 28-JUN-2024
DEFINITION  PREDICTED: Magallana gigas uncharacterized lncRNA (LOC136270079),
            ncRNA.
ACCESSION   XR_010707750
VERSION     XR_010707750.1
DBLINK      BioProject: PRJNA1118722
KEYWORDS    RefSeq.
SOURCE      Magallana gigas (Pacific oyster)
  ORGANISM  Magallana gigas
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Bivalvia;
            Autobranchia; Pteriomorphia; Ostreida; Ostreoidea; Ostreidae;
            Magallana.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_088859) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_963853765.1-RS_2024_06
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 06/20/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..325
                     /organism="Magallana gigas"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:29159"
                     /chromosome="7"
     gene            1..325
                     /gene="LOC136270079"
                     /note="uncharacterized LOC136270079; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:136270079"
     ncRNA           1..325
                     /ncRNA_class="lncRNA"
                     /gene="LOC136270079"
                     /product="uncharacterized lncRNA"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
                     /db_xref="GeneID:136270079"
ORIGIN      
cacagatccagcccgcctttcacagaacattcttgtacaaacacttcatacaacacatggagctccaaaagaggaattgttacaaaatacttatagatatctccgatcagattgattactaaattcaattatgtactacagtgtatcgtgtagctatcaatttgaccttgaatttaatgaatgaccttgaacttcgccttttgttttaaccatgaccttgaacttcgccttttgttttaacttggttacctcttagattacaaaatatgaattcattttcttattagtgtaaaagtaatggaagatagaaaaacaacaacaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]