GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-02 17:57:35, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XR_010609266             352 bp    RNA     linear   VRT 07-JUN-2024
DEFINITION  PREDICTED: Lathamus discolor uncharacterized LOC136006787
            (LOC136006787), ncRNA.
ACCESSION   XR_010609266
VERSION     XR_010609266.1
DBLINK      BioProject: PRJNA1119999
KEYWORDS    RefSeq.
SOURCE      Lathamus discolor (Swift parrot)
  ORGANISM  Lathamus discolor
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Neoaves; Telluraves; Australaves;
            Psittaciformes; Psittacidae; Lathamus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_027069385) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_037157495.1-RS_2024_06
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 06/06/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..352
                     /organism="Lathamus discolor"
                     /mol_type="transcribed RNA"
                     /isolate="bLatDis1"
                     /db_xref="taxon:678569"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="blood, muscle"
                     /dev_stage="adult"
                     /geo_loc_name="Australia: North Bruny, Tasmania"
                     /lat_lon="43.164424 S 147.319128 E"
                     /collection_date="2019-11-12"
                     /collected_by="Manuel Schweizer"
     gene            1..352
                     /gene="LOC136006787"
                     /note="uncharacterized LOC136006787; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:136006787"
     ncRNA           1..352
                     /ncRNA_class="lncRNA"
                     /gene="LOC136006787"
                     /product="uncharacterized LOC136006787"
                     /db_xref="GeneID:136006787"
ORIGIN      
cacccgcccgtcacccatcactgtcaccggcaccggccccggctcccgtcatgggcatttaagggcagccccacggtcccacagcacccacaggaccttcaggatgtgttccggtgctcagtgtctggtgaatctcctgcgctggatctggggcatcgtgcggcgcctctggggggggcacggagtgacccccccgcctccgcccgcagctgaaagaaggacgctggtgccggacaaagaggactgagcccccccagacctgacccccccaatggggaccttgaaccccccccatagggaccttgaaccccccagtggggaccccgcacccccccatagagaccctgaaccc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]