GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-29 06:05:51, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_009784843             798 bp    RNA     linear   VRT 23-DEC-2023
DEFINITION  PREDICTED: Phyllopteryx taeniolatus uncharacterized LOC133466093
            (LOC133466093), ncRNA.
ACCESSION   XR_009784843
VERSION     XR_009784843.1
DBLINK      BioProject: PRJNA1054098
KEYWORDS    RefSeq.
SOURCE      Phyllopteryx taeniolatus (common seadragon)
  ORGANISM  Phyllopteryx taeniolatus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Syngnathiaria; Syngnathiformes; Syngnathoidei;
            Syngnathidae; Phyllopteryx.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_084503) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_024500385.1-RS_2023_12
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 12/19/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..798
                     /organism="Phyllopteryx taeniolatus"
                     /mol_type="transcribed RNA"
                     /isolate="TA_2022b"
                     /db_xref="taxon:161469"
                     /chromosome="2"
                     /sex="female"
                     /tissue_type="liver"
                     /dev_stage="adult"
     gene            1..798
                     /gene="LOC133466093"
                     /note="uncharacterized LOC133466093; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:133466093"
     ncRNA           1..798
                     /ncRNA_class="lncRNA"
                     /gene="LOC133466093"
                     /product="uncharacterized LOC133466093"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
                     /db_xref="GeneID:133466093"
ORIGIN      
agttgctcaatgaagtggaagtgcgcaaaaaaattctttttggcacgctgtcctccggcgttaacaacacgtgaaagaggaacgaatgggacagcgtgtgtgtggctgtcaatgctgtggagtcagaacagcgcacacacgctgaactataaaagaagtggtcagacattaaggtggatgtgaagcaggggacagctgcccaccgctaccgtgtggccaaaacaggcggaagaaccgacgcgaagggccttaccccgttcgaggagagagtcgctgcaatcatgggtgacactactctttcgggagctgggagcacgtggctgactgatcactccacaaggagaggtcacgcagtcgcagccacgcgctacatgttcaggggattcgtcaacattccccagtcgtccaccgttctgccgtctcctccggcatgccctccaacaactggctgctgctgcccgcccgactggtcgtgtcctcacccgtgcgcactgataaagagtccttcaaattatcttaatttgaacatgtacatcagttgtgcatgatcaaaatgtgttaaaattacataatttacccctgccctcctaaaaaaaaatttttttaacacatttgaataatgtgcaaatgatgtacatgttcaaattttgtaaattcaaaggactctttttttcagtgcatgtgctggagtcacaagaagagattgtgagggcaataggcggcatatgatcgccttgatcaattaataggtatccttacaaatgtgtgattcatttaataaactggtaaacaagtgaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]