GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-18 17:08:03, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_008692074             335 bp    RNA     linear   INV 21-APR-2023
DEFINITION  PREDICTED: Paramacrobiotus metropolitanus uncharacterized
            LOC129600550 (LOC129600550), ncRNA.
ACCESSION   XR_008692074
VERSION     XR_008692074.1
DBLINK      BioProject: PRJNA953396
KEYWORDS    RefSeq.
SOURCE      Paramacrobiotus metropolitanus
  ORGANISM  Paramacrobiotus metropolitanus
            Eukaryota; Metazoa; Ecdysozoa; Tardigrada; Eutardigrada; Parachela;
            Macrobiotoidea; Macrobiotidae; Paramacrobiotus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_026570402) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_019649055.1-RS_2023_04
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 04/13/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..335
                     /organism="Paramacrobiotus metropolitanus"
                     /mol_type="transcribed RNA"
                     /isolate="TYO"
                     /isolation_source="bamboo leaf litter"
                     /db_xref="taxon:2943436"
                     /chromosome="Unknown"
                     /country="Japan: Tokyo, Nishi-Tokyo-shi, Tozenji temple"
                     /collection_date="2006-11"
                     /collected_by="Takekazu Kunieda"
     gene            1..335
                     /gene="LOC129600550"
                     /note="uncharacterized LOC129600550; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:129600550"
     ncRNA           1..335
                     /ncRNA_class="lncRNA"
                     /gene="LOC129600550"
                     /product="uncharacterized LOC129600550"
                     /db_xref="GeneID:129600550"
ORIGIN      
gccagaccgggaagatacgagaattggaacaactgctggtgtggggtgctaccaatgcttcttttcctccacctaacgagccgctatgtggatatctcaagcaactcccgccgtgtatgcctggtgataatcgatttacatacattctgtcgatcagtttagtttgttcgttcggggccctcactattttgggatgcgcagtgtacatcaaacgcaaagcagacaatcagttgctccgtgacccatggtggcaagtgtatctgcaagcaccagattacagagtagtatcccggcactcgatatcagtttcacgagcagtatctcggcactcgatt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]