2024-05-18 17:08:03, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_008692074 335 bp RNA linear INV 21-APR-2023 DEFINITION PREDICTED: Paramacrobiotus metropolitanus uncharacterized LOC129600550 (LOC129600550), ncRNA. ACCESSION XR_008692074 VERSION XR_008692074.1 DBLINK BioProject: PRJNA953396 KEYWORDS RefSeq. SOURCE Paramacrobiotus metropolitanus ORGANISM Paramacrobiotus metropolitanus Eukaryota; Metazoa; Ecdysozoa; Tardigrada; Eutardigrada; Parachela; Macrobiotoidea; Macrobiotidae; Paramacrobiotus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_026570402) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_019649055.1-RS_2023_04 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 04/13/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..335 /organism="Paramacrobiotus metropolitanus" /mol_type="transcribed RNA" /isolate="TYO" /isolation_source="bamboo leaf litter" /db_xref="taxon:2943436" /chromosome="Unknown" /country="Japan: Tokyo, Nishi-Tokyo-shi, Tozenji temple" /collection_date="2006-11" /collected_by="Takekazu Kunieda" gene 1..335 /gene="LOC129600550" /note="uncharacterized LOC129600550; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:129600550" ncRNA 1..335 /ncRNA_class="lncRNA" /gene="LOC129600550" /product="uncharacterized LOC129600550" /db_xref="GeneID:129600550" ORIGIN
gccagaccgggaagatacgagaattggaacaactgctggtgtggggtgctaccaatgcttcttttcctccacctaacgagccgctatgtggatatctcaagcaactcccgccgtgtatgcctggtgataatcgatttacatacattctgtcgatcagtttagtttgttcgttcggggccctcactattttgggatgcgcagtgtacatcaaacgcaaagcagacaatcagttgctccgtgacccatggtggcaagtgtatctgcaagcaccagattacagagtagtatcccggcactcgatatcagtttcacgagcagtatctcggcactcgatt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]