GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-18 16:24:01, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_007827910             666 bp    RNA     linear   VRT 26-FEB-2023
DEFINITION  PREDICTED: Labeo rohita uncharacterized LOC127166457
            (LOC127166457), ncRNA.
ACCESSION   XR_007827910
VERSION     XR_007827910.1
DBLINK      BioProject: PRJNA887821
KEYWORDS    RefSeq.
SOURCE      Labeo rohita (rohu)
  ORGANISM  Labeo rohita
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Cyprinidae; Labeoninae; Labeonini; Labeo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_066874) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_022985175.1-RS_2023_02
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 02/26/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..666
                     /organism="Labeo rohita"
                     /mol_type="transcribed RNA"
                     /strain="BAU-BD-2019"
                     /isolation_source="riverine"
                     /db_xref="taxon:84645"
                     /chromosome="6"
                     /sex="male"
                     /tissue_type="blood"
                     /dev_stage="adult"
     gene            1..666
                     /gene="LOC127166457"
                     /note="uncharacterized LOC127166457; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:127166457"
     ncRNA           1..666
                     /ncRNA_class="lncRNA"
                     /gene="LOC127166457"
                     /product="uncharacterized LOC127166457"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
                     /db_xref="GeneID:127166457"
ORIGIN      
aggagagggggcatgatttttgtcgactataaaaacccgtcactggccaggctgattcacaggacctgcaggtacggaaaggaccatgtcgactgaggccttccatcagagcaacctggatgtgaaactaggtgagccagacaggtaaagggtaggggacacatctgacgaatgaaaagcttcggattcaaatttttgacagtattttctacagtatttttggagtttatcacagtgcacatccagtacttcgatggataaaactgcacttgctttacgttgagccacacgcacaatacatgtggattcagttttgttcgttcggctcgcgttaagcaagtgcagaacttcttcggtgcaaacgtctgtgacctttttggattagaagcataactgctgtgcttttttgtttggaattgttttttagatggaaaaccacataaatgcaaccgttggtgtgagattttcacagacaaatgaatgagtcacaactgataatttatcttctgaaatggtcatgatttacaatgtcacctgttatccaacatcatgtttgttgagttattcacttcctctcttctgtgctggttttaaatgagtgagggcgaagttctcacatatgctgcggtgatgtaatggcaaaataaagttcttctcaactcctca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]