2024-05-18 16:24:01, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_007827910 666 bp RNA linear VRT 26-FEB-2023 DEFINITION PREDICTED: Labeo rohita uncharacterized LOC127166457 (LOC127166457), ncRNA. ACCESSION XR_007827910 VERSION XR_007827910.1 DBLINK BioProject: PRJNA887821 KEYWORDS RefSeq. SOURCE Labeo rohita (rohu) ORGANISM Labeo rohita Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Cyprinidae; Labeoninae; Labeonini; Labeo. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_066874) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_022985175.1-RS_2023_02 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 02/26/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..666 /organism="Labeo rohita" /mol_type="transcribed RNA" /strain="BAU-BD-2019" /isolation_source="riverine" /db_xref="taxon:84645" /chromosome="6" /sex="male" /tissue_type="blood" /dev_stage="adult" gene 1..666 /gene="LOC127166457" /note="uncharacterized LOC127166457; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:127166457" ncRNA 1..666 /ncRNA_class="lncRNA" /gene="LOC127166457" /product="uncharacterized LOC127166457" /experiment="COORDINATES: polyA evidence [ECO:0006239]" /db_xref="GeneID:127166457" ORIGIN
aggagagggggcatgatttttgtcgactataaaaacccgtcactggccaggctgattcacaggacctgcaggtacggaaaggaccatgtcgactgaggccttccatcagagcaacctggatgtgaaactaggtgagccagacaggtaaagggtaggggacacatctgacgaatgaaaagcttcggattcaaatttttgacagtattttctacagtatttttggagtttatcacagtgcacatccagtacttcgatggataaaactgcacttgctttacgttgagccacacgcacaatacatgtggattcagttttgttcgttcggctcgcgttaagcaagtgcagaacttcttcggtgcaaacgtctgtgacctttttggattagaagcataactgctgtgcttttttgtttggaattgttttttagatggaaaaccacataaatgcaaccgttggtgtgagattttcacagacaaatgaatgagtcacaactgataatttatcttctgaaatggtcatgatttacaatgtcacctgttatccaacatcatgtttgttgagttattcacttcctctcttctgtgctggttttaaatgagtgagggcgaagttctcacatatgctgcggtgatgtaatggcaaaataaagttcttctcaactcctca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]