2024-05-05 17:24:27, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_007758067 1289 bp RNA linear INV 30-SEP-2022 DEFINITION PREDICTED: Eriocheir sinensis uncharacterized LOC127004858 (LOC127004858), ncRNA. ACCESSION XR_007758067 VERSION XR_007758067.1 DBLINK BioProject: PRJNA883401 KEYWORDS RefSeq. SOURCE Eriocheir sinensis (Chinese mitten crab) ORGANISM Eriocheir sinensis Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Crustacea; Multicrustacea; Malacostraca; Eumalacostraca; Eucarida; Decapoda; Pleocyemata; Brachyura; Eubrachyura; Grapsoidea; Varunidae; Eriocheir. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_066537) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: Eriocheir sinensis Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1289 /organism="Eriocheir sinensis" /mol_type="transcribed RNA" /db_xref="taxon:95602" /chromosome="29" /sex="male" /tissue_type="muscle" /dev_stage="adult" /breed="Jianghai 21" gene 1..1289 /gene="LOC127004858" /note="uncharacterized LOC127004858; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:127004858" ncRNA 1..1289 /ncRNA_class="lncRNA" /gene="LOC127004858" /product="uncharacterized LOC127004858" /db_xref="GeneID:127004858" ORIGIN
tgcccgccaccagcaacatggcgccaactccagccaatgcaatcaatagcatgcaatataatcccctcctggctgaccctgcgtgcccctgtggcttgccctgctcccgggggcgtgcagggagtggtgggcgctcctgggggcgcgggcgggcaggaggctgagggcgggatgggcgccactagccacaccagcctccatcaatagcatgcaatataatcccttcctggccgccccctgtggcctgacctgttcccgggggcgtgcagggagtggagggcgtgggcgggcaggaggctgagggcgggaagggcgccacttcagccacacagcctcctgcccgtccagcctccatctaatacgcaaatcattttagcctttaacgccgcctctcgttacgcattctgccaactcatgggtatgcgtgcccccggggaacctcgcctgtgctgggctgccccggggaggctgcgggggcgcctgtcacgcctaaaacaccgtggcaaaagtctgtctgtctgtgtttgtttggctgggtggcaccaagttggggaccttggacttggtgtttggccttccttggcggggtagcagagggaaaggtcattaaaacacagtgattaaaggtcgggacaccacacacggcagtcttgaccataattattatacgtaaggcaaggtttgaagggagtggagaccttgaacttgtttggccttccttggcgggttagcagagggaaaggtcattaaaacacagtgattaaaggtcgagacaccacacacggcagtcttgatcttaattattgtacgtaaggcaaggtttgaagggagtggagaccttgaacttatttggccttccttggcgggctagcagagggaaaggtcattaaaacacagtgattaaaggtcaggacaccacacacggcagtcttgaccttggttattctacgtaaggcaaggtttgaagggagtggagaccttgaacttatttggccttctttggcgggctagcagatggaaaggtcattaaaacacagtgattaaaggtcaggacaccatacatgacagtcttgaccttggttattctacgtaaggcaaggtttgaagggagtggagaccttgaacttatttggccttctttgacaagctactagagagaaaggtcattagaacactgattaaaggtcgggataccgcacatggcagccttgaccttagttattatacagaaggcaaggtttgaagagagtggagactttgaacttatttggccttccttgacaagctac
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]