2024-05-05 10:09:01, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_007321529 107 bp RNA linear PLN 23-JUN-2022 DEFINITION PREDICTED: Brassica napus small nucleolar RNA R71 (LOC125584617), ncRNA. ACCESSION XR_007321529 VERSION XR_007321529.1 DBLINK BioProject: PRJNA844685 KEYWORDS RefSeq. SOURCE Brassica napus (rape) ORGANISM Brassica napus Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Brassiceae; Brassica. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_063446) annotated using gene prediction method: cmsearch. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Brassica napus Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..107 /organism="Brassica napus" /mol_type="transcribed RNA" /cultivar="Da-Ae" /db_xref="taxon:3708" /chromosome="C3" /tissue_type="Seedling" /dev_stage="Seedling" /country="USA" gene 1..107 /gene="LOC125584617" /note="Derived by automated computational analysis using gene prediction method: cmsearch." /db_xref="GeneID:125584617" ncRNA 1..107 /ncRNA_class="snoRNA" /gene="LOC125584617" /product="small nucleolar RNA R71" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00097" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:125584617" /db_xref="RFAM:RF00097" ORIGIN
aagccatgatgtgggcattgagaccaatagaccttgaacctctcccatgcttcactaaatccctatacgttcttctgctgaaagctagagatctcattcctgatctt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]