GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-05 10:09:01, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_007321529             107 bp    RNA     linear   PLN 23-JUN-2022
DEFINITION  PREDICTED: Brassica napus small nucleolar RNA R71 (LOC125584617),
            ncRNA.
ACCESSION   XR_007321529
VERSION     XR_007321529.1
DBLINK      BioProject: PRJNA844685
KEYWORDS    RefSeq.
SOURCE      Brassica napus (rape)
  ORGANISM  Brassica napus
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Brassiceae; Brassica.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_063446) annotated using gene prediction method: cmsearch.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Brassica napus Annotation Release
                                           102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..107
                     /organism="Brassica napus"
                     /mol_type="transcribed RNA"
                     /cultivar="Da-Ae"
                     /db_xref="taxon:3708"
                     /chromosome="C3"
                     /tissue_type="Seedling"
                     /dev_stage="Seedling"
                     /country="USA"
     gene            1..107
                     /gene="LOC125584617"
                     /note="Derived by automated computational analysis using
                     gene prediction method: cmsearch."
                     /db_xref="GeneID:125584617"
     ncRNA           1..107
                     /ncRNA_class="snoRNA"
                     /gene="LOC125584617"
                     /product="small nucleolar RNA R71"
                     /inference="COORDINATES: nucleotide
                     motif:Rfam:12.0:RF00097"
                     /inference="COORDINATES: profile:INFERNAL:1.1.1"
                     /db_xref="GeneID:125584617"
                     /db_xref="RFAM:RF00097"
ORIGIN      
aagccatgatgtgggcattgagaccaatagaccttgaacctctcccatgcttcactaaatccctatacgttcttctgctgaaagctagagatctcattcctgatctt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]