2024-05-05 07:24:45, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_007292535 78 bp RNA linear PLN 16-JUN-2022 DEFINITION PREDICTED: Triticum urartu small nucleolar RNA snoR35 (LOC125529027), ncRNA. ACCESSION XR_007292535 VERSION XR_007292535.1 DBLINK BioProject: PRJNA702518 KEYWORDS RefSeq. SOURCE Triticum urartu ORGANISM Triticum urartu Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP clade; Pooideae; Triticodae; Triticeae; Triticinae; Triticum. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_024115956.1) annotated using gene prediction method: cmsearch. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Triticum urartu Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..78 /organism="Triticum urartu" /mol_type="transcribed RNA" /cultivar="G1812" /db_xref="taxon:4572" /chromosome="Unknown" /tissue_type="leaf" /country="Turkey: Mardin" gene 1..78 /gene="LOC125529027" /note="Derived by automated computational analysis using gene prediction method: cmsearch." /db_xref="GeneID:125529027" ncRNA 1..78 /ncRNA_class="snoRNA" /gene="LOC125529027" /product="small nucleolar RNA snoR35" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF01281" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:125529027" /db_xref="RFAM:RF01281" ORIGIN
cagagtgatggagaccttgaactgatccagattgaccagaaaaggatgttgcaaatggtcgtccggttgagtctggaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]