GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-05 07:24:45, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_007292535              78 bp    RNA     linear   PLN 16-JUN-2022
DEFINITION  PREDICTED: Triticum urartu small nucleolar RNA snoR35
            (LOC125529027), ncRNA.
ACCESSION   XR_007292535
VERSION     XR_007292535.1
DBLINK      BioProject: PRJNA702518
KEYWORDS    RefSeq.
SOURCE      Triticum urartu
  ORGANISM  Triticum urartu
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP
            clade; Pooideae; Triticodae; Triticeae; Triticinae; Triticum.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_024115956.1) annotated using gene prediction method: cmsearch.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Triticum urartu Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..78
                     /organism="Triticum urartu"
                     /mol_type="transcribed RNA"
                     /cultivar="G1812"
                     /db_xref="taxon:4572"
                     /chromosome="Unknown"
                     /tissue_type="leaf"
                     /country="Turkey: Mardin"
     gene            1..78
                     /gene="LOC125529027"
                     /note="Derived by automated computational analysis using
                     gene prediction method: cmsearch."
                     /db_xref="GeneID:125529027"
     ncRNA           1..78
                     /ncRNA_class="snoRNA"
                     /gene="LOC125529027"
                     /product="small nucleolar RNA snoR35"
                     /inference="COORDINATES: nucleotide
                     motif:Rfam:12.0:RF01281"
                     /inference="COORDINATES: profile:INFERNAL:1.1.1"
                     /db_xref="GeneID:125529027"
                     /db_xref="RFAM:RF01281"
ORIGIN      
cagagtgatggagaccttgaactgatccagattgaccagaaaaggatgttgcaaatggtcgtccggttgagtctggaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]