GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-19 12:11:12, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_007016363             162 bp    RNA     linear   INV 28-MAR-2022
DEFINITION  PREDICTED: Schistocerca piceifrons U1 spliceosomal RNA
            (LOC124790899), ncRNA.
ACCESSION   XR_007016363
VERSION     XR_007016363.1
DBLINK      BioProject: PRJNA799999
KEYWORDS    RefSeq.
SOURCE      Schistocerca piceifrons (Central American locust)
  ORGANISM  Schistocerca piceifrons
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Polyneoptera; Orthoptera; Caelifera;
            Acrididea; Acridomorpha; Acridoidea; Acrididae;
            Cyrtacanthacridinae; Schistocerca.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_060140) annotated using gene prediction method: cmsearch.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Schistocerca piceifrons Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..162
                     /organism="Schistocerca piceifrons"
                     /mol_type="transcribed RNA"
                     /isolate="TAMUIC-IGC-003096"
                     /isolation_source="physical"
                     /specimen_voucher="TAMUIC-IGC-003096"
                     /db_xref="taxon:274613"
                     /chromosome="3"
                     /sex="female"
                     /tissue_type="Whole body"
                     /dev_stage="adult"
                     /country="Mexico: Yucatan, nr. Tizimin"
                     /collection_date="2021-03-08"
                     /collected_by="Hojun Song"
                     /identified_by="Hojun Song"
     gene            1..162
                     /gene="LOC124790899"
                     /note="Derived by automated computational analysis using
                     gene prediction method: cmsearch."
                     /db_xref="GeneID:124790899"
     ncRNA           1..162
                     /ncRNA_class="snRNA"
                     /gene="LOC124790899"
                     /product="U1 spliceosomal RNA"
                     /inference="COORDINATES: nucleotide
                     motif:Rfam:12.0:RF00003"
                     /inference="COORDINATES: profile:INFERNAL:1.1.1"
                     /db_xref="GeneID:124790899"
                     /db_xref="RFAM:RF00003"
ORIGIN      
atacttaccttgcatagaggacaatgtgattatgaacgtgattcctggtaggtgcggctgatccattgcacttaggtcatgctgacctctgctattgcgccaaacacgggtaactcgggcgaaaaactttttgtagtcggaaatacttcagtgcattgccgg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]