2024-04-19 12:11:12, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_007016363 162 bp RNA linear INV 28-MAR-2022 DEFINITION PREDICTED: Schistocerca piceifrons U1 spliceosomal RNA (LOC124790899), ncRNA. ACCESSION XR_007016363 VERSION XR_007016363.1 DBLINK BioProject: PRJNA799999 KEYWORDS RefSeq. SOURCE Schistocerca piceifrons (Central American locust) ORGANISM Schistocerca piceifrons Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Polyneoptera; Orthoptera; Caelifera; Acrididea; Acridomorpha; Acridoidea; Acrididae; Cyrtacanthacridinae; Schistocerca. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_060140) annotated using gene prediction method: cmsearch. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Schistocerca piceifrons Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..162 /organism="Schistocerca piceifrons" /mol_type="transcribed RNA" /isolate="TAMUIC-IGC-003096" /isolation_source="physical" /specimen_voucher="TAMUIC-IGC-003096" /db_xref="taxon:274613" /chromosome="3" /sex="female" /tissue_type="Whole body" /dev_stage="adult" /country="Mexico: Yucatan, nr. Tizimin" /collection_date="2021-03-08" /collected_by="Hojun Song" /identified_by="Hojun Song" gene 1..162 /gene="LOC124790899" /note="Derived by automated computational analysis using gene prediction method: cmsearch." /db_xref="GeneID:124790899" ncRNA 1..162 /ncRNA_class="snRNA" /gene="LOC124790899" /product="U1 spliceosomal RNA" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00003" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:124790899" /db_xref="RFAM:RF00003" ORIGIN
atacttaccttgcatagaggacaatgtgattatgaacgtgattcctggtaggtgcggctgatccattgcacttaggtcatgctgacctctgctattgcgccaaacacgggtaactcgggcgaaaaactttttgtagtcggaaatacttcagtgcattgccgg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]