2025-10-23 14:35:52, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XR_006899862 343 bp RNA linear INV 14-FEB-2022 DEFINITION PREDICTED: Haliotis rubra uncharacterized LOC124281168 (LOC124281168), ncRNA. ACCESSION XR_006899862 VERSION XR_006899862.1 DBLINK BioProject: PRJNA801670 KEYWORDS RefSeq. SOURCE Haliotis rubra (blacklip abalone) ORGANISM Haliotis rubra Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Vetigastropoda; Lepetellida; Haliotoidea; Haliotidae; Haliotis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_025766891) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Haliotis rubra Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..343 /organism="Haliotis rubra" /mol_type="transcribed RNA" /isolate="DU_JTF1" /isolation_source="Aquaculture farm" /db_xref="taxon:36100" /chromosome="Unknown" /tissue_type="muscle" /dev_stage="adult" /geo_loc_name="Australia: Jade Tiger Abalone Farm, Indented Head, Victoria" /collection_date="2017" /collected_by="Adam Miller" gene 1..343 /gene="LOC124281168" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 10 samples with support for all annotated introns" /db_xref="GeneID:124281168" ncRNA 1..343 /ncRNA_class="lncRNA" /gene="LOC124281168" /product="uncharacterized LOC124281168" /db_xref="GeneID:124281168" ORIGIN
gtgcacatcaaggttttgaccaattctgcagaagacttgaaacgcttggcgtattaggagcgctaaaacatcatggaacacgcatgaaagaagtttttgtatatgaaaaaaggcttctggattctacaacaatagaactattgttcgagccagatttagcagaggccaactccaaccgacgccgccaagaagagattgttctctcaaactggagagattttcttcttgatttggaagaaggtacggaagtccccacactcaaagacctcttggtgtttgtgaccggggctgacggaatcccgcctctgggattcgacccctctccacacctgctgtttcactc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]