2024-05-05 08:41:41, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_006784729 107 bp RNA linear MAM 12-JAN-2022 DEFINITION PREDICTED: Phyllostomus hastatus U6 spliceosomal RNA (LOC123813301), ncRNA. ACCESSION XR_006784729 VERSION XR_006784729.1 DBLINK BioProject: PRJNA768865 KEYWORDS RefSeq. SOURCE Phyllostomus hastatus (greater spear-nosed bat) ORGANISM Phyllostomus hastatus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Chiroptera; Microchiroptera; Phyllostomidae; Phyllostominae; Phyllostomus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_025333611.1) annotated using gene prediction method: cmsearch. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Phyllostomus hastatus Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..107 /organism="Phyllostomus hastatus" /mol_type="transcribed RNA" /isolate="PE091" /db_xref="taxon:9423" /chromosome="Unknown" /sex="male" /tissue_type="liver" /dev_stage="adult" /country="Peru: Loreto, Requena, Jenaro Herrera" /collection_date="2015-05-20" /collected_by="Laurel R. Yohe" gene 1..107 /gene="LOC123813301" /note="Derived by automated computational analysis using gene prediction method: cmsearch." /db_xref="GeneID:123813301" ncRNA 1..107 /ncRNA_class="snRNA" /gene="LOC123813301" /product="U6 spliceosomal RNA" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00026" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:123813301" /db_xref="RFAM:RF00026" ORIGIN
actgcgttcaccttggtagtagtttcaaaaactggaatgacacagagaagacagcacggaccttgaacaatgataacacataatatcacgaaatgttccatatctta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]