2024-05-18 13:51:44, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_006535435 351 bp RNA linear INV 27-OCT-2021 DEFINITION PREDICTED: Chrysoperla carnea uncharacterized LOC123301486 (LOC123301486), ncRNA. ACCESSION XR_006535435 VERSION XR_006535435.1 DBLINK BioProject: PRJNA774319 KEYWORDS RefSeq. SOURCE Chrysoperla carnea ORGANISM Chrysoperla carnea Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Neuroptera; Hemerobiiformia; Chrysopidae; Chrysopinae; Chrysoperla. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_058341.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Chrysoperla carnea Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..351 /organism="Chrysoperla carnea" /mol_type="transcribed RNA" /db_xref="taxon:189513" /chromosome="5" gene 1..351 /gene="LOC123301486" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 4 samples with support for all annotated introns" /db_xref="GeneID:123301486" ncRNA 1..351 /ncRNA_class="lncRNA" /gene="LOC123301486" /product="uncharacterized LOC123301486" /db_xref="GeneID:123301486" ORIGIN
tcacaggatgatttttgtgtgcaaattattcaattgaaacagtggtgtgcattagcacctttgccaaaactcagtaaaagagatgttattcaattttggcaagatgtgaataaaatttgtgaagataacacaacattagtaacttgctatgatggagcattggctagtggtttatttacagctttatcatttatcatcgaacaaatagattttgaacatgaatgtgatatttcattggctgttcgaacaattcgacataatcgacccaattttgttcgttcggaagaacaatttaaatacttatatgagattgcaataagttatgtcgacagttttagcacatactcgaat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]