LOCUS       XR_006173805             939 bp    RNA     linear   VRT 09-AUG-2021
DEFINITION  PREDICTED: Chrysemys picta bellii high mobility group AT-hook 1
            (HMGA1), transcript variant X3, misc_RNA.
ACCESSION   XR_006173805
VERSION     XR_006173805.1
DBLINK      BioProject: PRJNA210179
KEYWORDS    RefSeq.
SOURCE      Chrysemys picta bellii (western painted turtle)
  ORGANISM  Chrysemys picta bellii
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Testudinata; Testudines; Cryptodira; Durocryptodira;
            Testudinoidea; Emydidae; Chrysemys.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_024943629.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Chrysemys picta Annotation Release
                                           103
            Annotation Version          :: 103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..939
                     /organism="Chrysemys picta bellii"
                     /mol_type="transcribed RNA"
                     /isolate="RCT428"
                     /isolation_source="small lake 1.3 miles south of Potholes
                     Reservoir"
                     /sub_species="bellii"
                     /db_xref="taxon:8478"
                     /chromosome="Unknown"
                     /sex="female"
                     /country="USA: Grant Co., WA"
     gene            1..939
                     /gene="HMGA1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 3 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 12 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:101932679"
     misc_RNA        1..939
                     /gene="HMGA1"
                     /product="high mobility group AT-hook 1, transcript
                     variant X3"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
                     /db_xref="GeneID:101932679"
ORIGIN      

ttttcttctctctctctccttcatttcttttgcaaagagcaggtagtgcattgggctcgcaagaaaccccgcctcctcctggccctttaaaggggcagatcccagagccatgtctccccctctccaaccaagaagagattgtgaaagacgatgagtgaatctagtgcaaaatccagccagcccttggcttccaaacaggaggaggacgtgtctgagaagagaggacggggacgacccaggaagaagcctcagcaggaacccagcgaggcaccaacccccaagagaccacgtggcagaccaaaggggagcaaaaataaggccacttctaaaggcaggaaagctgcagtaacacctgggaggaaacctcgaggccggcccaaaaaatcgcagaaggacgaagaggaggtgaacgtttcgcaggagtcatccgaagaggagcagtgaaaacgcttgaacccggcactacctcatcattcaacttaccaatttctcgtcaagttcttggactgaggaaggaacgaaacaaaacaaaaatccttggtactcttctcatgctccatgcctcaggctgggaattagactcagcaggaaagtacacagcgtgagcatctgcctccagtgacctacgggcccagagatcccttcgccacaccacactccatcccttagctacgaccaactgcagcggagctggaggttattactatggggaaggccaagggggtgaaagcagttttgggttttacgttgagagtttttactgggtgttcaagtcacctgtccagcagggcggggagggaccatgtgagcgtaagtcgcgtctggagaaagcaggcaggtggctgacagttggcaagaagtggaggtttttttggcccattgttaaagaccttttggtttcctatttgcagttacttgaataaaacattttacggatgt

//