2024-04-25 13:01:19, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_006126834 348 bp RNA linear PLN 19-JUL-2021 DEFINITION PREDICTED: Zingiber officinale uncharacterized LOC122034943 (LOC122034943), transcript variant X3, ncRNA. ACCESSION XR_006126834 VERSION XR_006126834.1 DBLINK BioProject: PRJNA736965 KEYWORDS RefSeq. SOURCE Zingiber officinale ORGANISM Zingiber officinale Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Zingiberales; Zingiberaceae; Zingiber. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_056007.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Zingiber officinale Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..348 /organism="Zingiber officinale" /mol_type="transcribed RNA" /cultivar="Zhangliang" /db_xref="taxon:94328" /chromosome="11B" /tissue_type="rhizome" /country="China: Zhengzhou" gene 1..348 /gene="LOC122034943" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 7 samples with support for all annotated introns" /db_xref="GeneID:122034943" ncRNA 1..348 /ncRNA_class="lncRNA" /gene="LOC122034943" /product="uncharacterized LOC122034943, transcript variant X3" /db_xref="GeneID:122034943" ORIGIN
ggtgggaatcaagggaaacggcgttggatctgggcatcggcgaccggctgtgtgaggtaacgcccattgtttccttccgatttttcccttgttttgttcgtcggcaagaacaagtcgagccctaacttcgatctcggagagattggtgtcttgtttctggccaccacagctggactagatcaactcctccaccggatctgtgatcgtactctagccaagatcctgagagaagcagagcttgtgttgtgattccggccactacagctctggtggggattgctcttcttcctcagatctgtggtttgctccggcgatcaagaagagattgttaacaccgaatccttatag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]