GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-12-06 04:46:20, GGRNA.v2 : RefSeq release 208 (Sep, 2021)

LOCUS       XR_005701441            3350 bp    RNA     linear   VRT 15-MAR-2021
DEFINITION  PREDICTED: Hirundo rustica NRDE-2, necessary for RNA interference,
            domain containing (NRDE2), transcript variant X2, misc_RNA.
ACCESSION   XR_005701441
VERSION     XR_005701441.1
DBLINK      BioProject: PRJNA713843
KEYWORDS    RefSeq.
SOURCE      Hirundo rustica (Barn swallow)
  ORGANISM  Hirundo rustica
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Passeriformes; Sylvioidea;
            Hirundinidae; Hirundo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_053455.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Hirundo rustica Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.6
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3350
                     /organism="Hirundo rustica"
                     /mol_type="transcribed RNA"
                     /isolate="bHirRus1"
                     /db_xref="taxon:43150"
                     /chromosome="6"
                     /sex="female"
                     /tissue_type="muscle"
                     /dev_stage="adult"
                     /country="Italy"
                     /collection_date="22-May-2018"
                     /collected_by="Giulio Formenti, Nicola Saino"
     gene            1..3350
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 7 ESTs, 1 long SRA read, and 99%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 3 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:120754445"
     misc_RNA        1..3350
                     /gene="NRDE2"
                     /product="NRDE-2, necessary for RNA interference, domain
                     containing, transcript variant X2"
                     /db_xref="GeneID:120754445"
ORIGIN      
cgctcgggcggggggcggcggcggcggccgagacatggcgctgttcccggccttcgccggggccgcccagcccggggagccccccgccggcagctccgagggctccacgagagagttagactggcttagtaacccaagcttctctgcagaagatgcactgttactgcaccagcgcactacagaagttgccaatctcgttcctgaaaaatcaccattaacaaggacttcttcaagatctgagttgtcagaggagagtgatacagatgagagtctgaaacagacaagtaagaaaaggaaaaagaaaaagaaaaaacatcaccacaataagaagacaaaaaagaaaaccaaaggggattccagtagcagcgaatcggatgtggacactaagcacaccaaggacaaaggaagtggcaaaaatagtggaaaggaagcagcagcaaatcagggtaagaaagcatcaaatgttaccagcagtcgctctatttggcttgatgatatccaggcccccacagctggcaccttccggatagacaagaaaccagaccctgcaaactgggcctacaaatccttgtaccgtggggacatcgcaaggtataaaaggaaaggagagtcctgtcttggcatagatgcaaaaaaacactgtataacttgggacagttctgcatcaaaaaagaagcgagcacagagtcgacctgagcgctactttacaaagaacaatgtgaagatgctgaacacagatggcattcttgtttgtaataaaaattctccatctgatccacctgcttttataccagtttcccaagtggaaagtgatgattcttcggacacaacagaagtaaatcctcttgggatttatgatccatcaaccacagtgtggctacaaggaaaagggtgcaagagcgcagacaatgagtctgtaaatgcacagcaaacaattcaagagcctgggataaacatgaactccattctaatgtcaaaagtggaagaatataacaagaaagtcagagaaaacccaagagatattaatgcttggatggaatttatttcctttcaggatgaattaatgagaggacctagcccttatgccagtcagggagagcaggaatcaaggagaaaatcactcaagttaatcttggaaaagaaactggccattttagagagggcaattgaaagcaatccaagtaatgttgatctgaaacttgccaggctgaagctttgcgcagaattctgggaaccaccagctttgattaaagaatggcagaagctaatttttttacatcccaataatccggagatgtggaagaaataccttctcttctgtcagagtcagttcaccaccttttccgtttcaaagatcaacagtctctatggaaaatgtttgacaacactggcagctgtccaggatggcagcatggtatcccatcctctgctgcctggcacggaagaagctatgctggctatatttattcagcagtgccactttctgagacaggctggccattctgagaaagcagtgtctttgtttcaggctctgattgacttcaccttctttaaacctgacagtgtaaaagatctgccaacaaggggacaggtggaattctttgaacccttttgggatagtggagaaccacgaattggagaaaaaggagcaagaggctggaaagcatggatgcaccaacaagaaaagggtggctgggtcgttcttaagcctgatgatgaggacgatgaagatctggatgaggatcaagaaataaaagataaaactcttcccaagtggcatatttggttggatattgaatattcccgtgaggcaaggcactggttaccttggaggccggacaaaaccaaaaaggaaactgaagaagattgtgaagatccagaaagacaggtgttatttgatgatcttggaccatctttaatccgtctttctaatccaaagcttcaacatcaactattgtactcttttttgcaattcctgggagttccatgtacaagtaaactctttccttccagtctctatattgccatggatgaaaataacatctttgacagtgtgctttatgatgataaaccgctgacttctgctgatttcccactttctggattcaacagtattggtcatatggatacaatgtcacgaggcagacatcagataggccactataaagaaggagaggagttcatacagaatgtcttccatgttctgtcccagatatttacaggaaaggaaaaatctaacctggccatttgttggctacagtatgaaatatctaaggtaattcagtgtctccaagcaaaaaagaaaaagaagctaaaagcacaaggcaggaagagtaaaaagttggccaagaatttccttaaagcacctgacaaccgaaacaacctttctctctggaaactctatgcctacctagaatggctgcttggtaacacagatgattccaggaaggtgtttgacacagctcttggcacagcaggggcaggaggattgaagagtgcccagctctgcagcctcagcctgctttacgctcagctggaggtggaactgctagaaagtgtagaaggagctgttacgtctcgggctgttcatatattgaccaaattgactgaaaatggactatatgtgccctacagtggacaagtgttacctgtgaacgtcttgaaagctcgtaaaacatacgagcatgcactgcaagattatttcagtaaagcaccagtttctgatcaggatcaggtcaaggatactgatcagctggttaacctggttggttgttatgcactgttccagtatttgactgttgggattgatgctgcagtattaatatatacacaggcttcagaaaaacttgaagtttctggttcacagaaacatgaaaatcctgtagagaattttggcattttgaattttcccagtgctcttgaagctgtcacactgctgcatacaaatctactgagattccacatgaaaattagtgtttatcctttgaatcccctgcgagaggcactaacggaggctctgaaacggtatcctagcaaccaatctctttggaggtcatacatccacatccaaaggaagtctcacagtgccagcaaagcacgaagattttttgatagtgtcacaaggtctgctaactctttagagccgtggctgtttgcaatccaagcagagcagatgagaaaaaaactcacagagaaggtccagagatgttggtgaaatacattgtactattcctgaaactggattaacaaatcggattgtagctctatttgaacatgcagttcagagtgaaaatggtacccattgtccactgctatggagaatgtatttgaactttatggcttcactagga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]