LOCUS       XR_005541109             148 bp    RNA     linear   PLN 29-JAN-2021
DEFINITION  PREDICTED: Dioscorea cayenensis subsp. rotundata uncharacterized
            LOC120275457 (LOC120275457), ncRNA.
ACCESSION   XR_005541109
VERSION     XR_005541109.1
DBLINK      BioProject: PRJNA695139
KEYWORDS    RefSeq.
SOURCE      Dioscorea cayenensis subsp. rotundata (Guinea yam)
  ORGANISM  Dioscorea cayenensis subsp. rotundata
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Dioscoreales;
            Dioscoreaceae; Dioscorea.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_052484.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Dioscorea cayenensis subsp.
                                           rotundata Annotation Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..148
                     /organism="Dioscorea cayenensis subsp. rotundata"
                     /mol_type="transcribed RNA"
                     /cultivar="TDr96_F1"
                     /sub_species="rotundata"
                     /db_xref="taxon:55577"
                     /chromosome="14"
                     /geo_loc_name="Japan:Iwate"
                     /collection_date="2016-06-01"
     gene            1..148
                     /gene="LOC120275457"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 2 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:120275457"
     ncRNA           1..148
                     /ncRNA_class="lncRNA"
                     /gene="LOC120275457"
                     /product="uncharacterized LOC120275457"
                     /db_xref="GeneID:120275457"
ORIGIN      

tgaaacccaaatcatgttttatgtttatggttgtagtaatgttcttcgtcatgtataagttgacaaaattccaacaggcacaagaagagattgaatcagtatctcagacttttgattccatgatgaggaggacaccaaagaagctgta

//