ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-01-25 21:50:56, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XR_005541109 148 bp RNA linear PLN 29-JAN-2021
DEFINITION PREDICTED: Dioscorea cayenensis subsp. rotundata uncharacterized
LOC120275457 (LOC120275457), ncRNA.
ACCESSION XR_005541109
VERSION XR_005541109.1
DBLINK BioProject: PRJNA695139
KEYWORDS RefSeq.
SOURCE Dioscorea cayenensis subsp. rotundata (Guinea yam)
ORGANISM Dioscorea cayenensis subsp. rotundata
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliopsida; Liliopsida; Dioscoreales;
Dioscoreaceae; Dioscorea.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_052484.1) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI
Annotation Status :: Full annotation
Annotation Name :: Dioscorea cayenensis subsp.
rotundata Annotation Release 100
Annotation Version :: 100
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 8.5
Annotation Method :: Best-placed RefSeq; Gnomon
Features Annotated :: Gene; mRNA; CDS; ncRNA
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..148
/organism="Dioscorea cayenensis subsp. rotundata"
/mol_type="transcribed RNA"
/cultivar="TDr96_F1"
/sub_species="rotundata"
/db_xref="taxon:55577"
/chromosome="14"
/geo_loc_name="Japan:Iwate"
/collection_date="2016-06-01"
gene 1..148
/gene="LOC120275457"
/note="Derived by automated computational analysis using
gene prediction method: Gnomon. Supporting evidence
includes similarity to: 100% coverage of the annotated
genomic feature by RNAseq alignments, including 2 samples
with support for all annotated introns"
/db_xref="GeneID:120275457"
ncRNA 1..148
/ncRNA_class="lncRNA"
/gene="LOC120275457"
/product="uncharacterized LOC120275457"
/db_xref="GeneID:120275457"
ORIGIN
tgaaacccaaatcatgttttatgtttatggttgtagtaatgttcttcgtcatgtataagttgacaaaattccaacaggcacaagaagagattgaatcagtatctcagacttttgattccatgatgaggaggacaccaaagaagctgta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]