2025-07-12 17:15:46, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XR_005455629 124 bp RNA linear MAM 06-JAN-2021 DEFINITION PREDICTED: Tachyglossus aculeatus U6atac minor spliceosomal RNA (LOC119943154), ncRNA. ACCESSION XR_005455629 VERSION XR_005455629.1 DBLINK BioProject: PRJNA687514 KEYWORDS RefSeq. SOURCE Tachyglossus aculeatus (Australian echidna) ORGANISM Tachyglossus aculeatus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Monotremata; Tachyglossidae; Tachyglossus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_052086.1) annotated using gene prediction method: cmsearch. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Tachyglossus aculeatus Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..124 /organism="Tachyglossus aculeatus" /mol_type="transcribed RNA" /isolate="mTacAcu1" /db_xref="taxon:9261" /chromosome="21" /sex="male" /tissue_type="liver" /dev_stage="adult" /geo_loc_name="Australia: Upper Barnard River, New South Wales" /lat_lon="31.647305 S 151.500011 E" /collected_by="Tasman Daish, Frank Grutzner" gene 1..124 /gene="LOC119943154" /note="Derived by automated computational analysis using gene prediction method: cmsearch." /db_xref="GeneID:119943154" ncRNA 1..124 /ncRNA_class="snRNA" /gene="LOC119943154" /product="U6atac minor spliceosomal RNA" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00619" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:119943154" /db_xref="RFAM:RF00619" ORIGIN
gtgctgtaggaaaggagaaaggttagcactcccctggaggatggaagaggtcatagtgacctttacaacacatgtaaggttaagatattgccaccgacttcatagcatctaaccatgttttaga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]