GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-12-06 04:49:59, GGRNA.v2 : RefSeq release 208 (Sep, 2021)

LOCUS       XR_005455629             124 bp    RNA     linear   MAM 06-JAN-2021
DEFINITION  PREDICTED: Tachyglossus aculeatus U6atac minor spliceosomal RNA
            (LOC119943154), ncRNA.
ACCESSION   XR_005455629
VERSION     XR_005455629.1
DBLINK      BioProject: PRJNA687514
KEYWORDS    RefSeq.
SOURCE      Tachyglossus aculeatus (Australian echidna)
  ORGANISM  Tachyglossus aculeatus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Monotremata; Tachyglossidae; Tachyglossus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_052086.1) annotated using gene prediction method: cmsearch.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Tachyglossus aculeatus Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..124
                     /organism="Tachyglossus aculeatus"
                     /mol_type="transcribed RNA"
                     /isolate="mTacAcu1"
                     /db_xref="taxon:9261"
                     /chromosome="21"
                     /sex="male"
                     /tissue_type="liver"
                     /dev_stage="adult"
                     /country="Australia: Upper Barnard River, New South Wales"
                     /lat_lon="31.647305 S 151.500011 E"
                     /collected_by="Tasman Daish, Frank Grutzner"
     gene            1..124
                     /gene="LOC119943154"
                     /note="Derived by automated computational analysis using
                     gene prediction method: cmsearch."
                     /db_xref="GeneID:119943154"
     ncRNA           1..124
                     /ncRNA_class="snRNA"
                     /gene="LOC119943154"
                     /product="U6atac minor spliceosomal RNA"
                     /inference="COORDINATES: nucleotide
                     motif:Rfam:12.0:RF00619"
                     /inference="COORDINATES: profile:INFERNAL:1.1.1"
                     /db_xref="GeneID:119943154"
                     /db_xref="RFAM:RF00619"
ORIGIN      
gtgctgtaggaaaggagaaaggttagcactcccctggaggatggaagaggtcatagtgacctttacaacacatgtaaggttaagatattgccaccgacttcatagcatctaaccatgttttaga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]