LOCUS       XR_005111947             570 bp    RNA     linear   INV 10-NOV-2020
DEFINITION  PREDICTED: Rhipicephalus microplus uncharacterized LOC119188222
            (LOC119188222), ncRNA.
ACCESSION   XR_005111947
VERSION     XR_005111947.1
DBLINK      BioProject: PRJNA674876
KEYWORDS    RefSeq.
SOURCE      Rhipicephalus microplus (Boophilus microplus)
  ORGANISM  Rhipicephalus microplus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Chelicerata; Arachnida;
            Acari; Parasitiformes; Ixodida; Ixodoidea; Ixodidae;
            Rhipicephalinae; Rhipicephalus; Boophilus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_051165.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Rhipicephalus microplus Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..570
                     /organism="Rhipicephalus microplus"
                     /mol_type="transcribed RNA"
                     /isolate="Rmic-2018"
                     /host="cattle"
                     /db_xref="taxon:6941"
                     /chromosome="1"
                     /tissue_type="Larvae"
                     /country="China: Guizhou"
                     /collection_date="01-Oct-2017"
     gene            1..570
                     /gene="LOC119188222"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 5 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:119188222"
     ncRNA           1..570
                     /ncRNA_class="lncRNA"
                     /gene="LOC119188222"
                     /product="uncharacterized LOC119188222"
                     /db_xref="GeneID:119188222"
ORIGIN      

tgcaagtgtgccggcagccgggcccacacgacgacggtcctcagtttcgtcccggagtccgaacgcaccggttgggctcctggtgcgcagcttggcctggccagtcggcacgcacgctcccctagaccacggactctcttgcacgtggcacgaggacagagtcttcccgcctttatagctcgtcgtacgcctaaagaggaacggcagcgcagaaacgtacacgataagagaatcatcgcagcagacttatcgcaagaccttcgactacgccttcttcccttttccgaggtcgcctccattcgacttctaagcctgcgaccacggtcacccttgcggggacaatgcacgccctggggctgactcgagctgcccgtgcaaaactggaacctttgcgttgttttgttcgttcggctcgagttaggaaccggcgtggaagcgccgttggatgcaaaccgacacgccctgccagggtctctatcgtcctgcctgccctttcccgtctcgcttgaagtgctccccgaagcgttcaataaagtttaccgtaatatttttttatgttcgaaccacggc

//