2025-07-06 13:46:24, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XR_004927981 574 bp RNA linear VRT 10-SEP-2020 DEFINITION PREDICTED: Fundulus heteroclitus uncharacterized LOC118557761 (LOC118557761), ncRNA. ACCESSION XR_004927981 VERSION XR_004927981.1 DBLINK BioProject: PRJNA615222 KEYWORDS RefSeq. SOURCE Fundulus heteroclitus (mummichog) ORGANISM Fundulus heteroclitus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Ovalentaria; Atherinomorphae; Cyprinodontiformes; Fundulidae; Fundulus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_046384.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Fundulus heteroclitus Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..574 /organism="Fundulus heteroclitus" /mol_type="transcribed RNA" /isolate="FHET01" /db_xref="taxon:8078" /chromosome="24" /sex="male" /tissue_type="pool" /dev_stage="adult" gene 1..574 /gene="LOC118557761" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:118557761" ncRNA 1..574 /ncRNA_class="lncRNA" /gene="LOC118557761" /product="uncharacterized LOC118557761" /db_xref="GeneID:118557761" ORIGIN
aggacaggagtgtttgacccttggtcgcaacgagttgggctgaattgttttcactttaattgccttctaaaatagaaggcaattaatttttttcttcacttcatcgcttgtgtgcctacaaggatatttttgccacggagacctttttactgaaaggttcgaagattttattacagttgacttctgctttgaccgtgacctctttagtattagatttcaggtcataatgacctggatttacactaaaagataccatgagattattctactgcaggcaacctgtccaaggtgtcccccaccactcaaccaatgaccgctggagatggacaccaggcactcccccaaccctacaacgataagcagatgattttacaccattacggtctgccagtgggagggtttccgtggaacaattcttctgaaaggaatccccggggacgcactcattcatatgatgtgtttcaacatagtgtttgagctgggaattgtcctgcgacgtgatgtactgcagtcataagagcagctgttgagacccctctatgggcgagtacatacagtttcttttttcttgtag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]