ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-10-06 20:44:22, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XR_004927981 574 bp RNA linear VRT 10-SEP-2020
DEFINITION PREDICTED: Fundulus heteroclitus uncharacterized LOC118557761
(LOC118557761), ncRNA.
ACCESSION XR_004927981
VERSION XR_004927981.1
DBLINK BioProject: PRJNA615222
KEYWORDS RefSeq.
SOURCE Fundulus heteroclitus (mummichog)
ORGANISM Fundulus heteroclitus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
Acanthomorphata; Ovalentaria; Atherinomorphae; Cyprinodontiformes;
Fundulidae; Fundulus.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_046384.1) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI
Annotation Status :: Full annotation
Annotation Name :: Fundulus heteroclitus Annotation
Release 102
Annotation Version :: 102
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 8.5
Annotation Method :: Best-placed RefSeq; Gnomon
Features Annotated :: Gene; mRNA; CDS; ncRNA
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..574
/organism="Fundulus heteroclitus"
/mol_type="transcribed RNA"
/isolate="FHET01"
/db_xref="taxon:8078"
/chromosome="24"
/sex="male"
/tissue_type="pool"
/dev_stage="adult"
gene 1..574
/gene="LOC118557761"
/note="Derived by automated computational analysis using
gene prediction method: Gnomon. Supporting evidence
includes similarity to: 100% coverage of the annotated
genomic feature by RNAseq alignments, including 1 sample
with support for all annotated introns"
/db_xref="GeneID:118557761"
ncRNA 1..574
/ncRNA_class="lncRNA"
/gene="LOC118557761"
/product="uncharacterized LOC118557761"
/db_xref="GeneID:118557761"
ORIGIN
aggacaggagtgtttgacccttggtcgcaacgagttgggctgaattgttttcactttaattgccttctaaaatagaaggcaattaatttttttcttcacttcatcgcttgtgtgcctacaaggatatttttgccacggagacctttttactgaaaggttcgaagattttattacagttgacttctgctttgaccgtgacctctttagtattagatttcaggtcataatgacctggatttacactaaaagataccatgagattattctactgcaggcaacctgtccaaggtgtcccccaccactcaaccaatgaccgctggagatggacaccaggcactcccccaaccctacaacgataagcagatgattttacaccattacggtctgccagtgggagggtttccgtggaacaattcttctgaaaggaatccccggggacgcactcattcatatgatgtgtttcaacatagtgtttgagctgggaattgtcctgcgacgtgatgtactgcagtcataagagcagctgttgagacccctctatgggcgagtacatacagtttcttttttcttgtag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]