LOCUS       XR_004927981             574 bp    RNA     linear   VRT 10-SEP-2020
DEFINITION  PREDICTED: Fundulus heteroclitus uncharacterized LOC118557761
            (LOC118557761), ncRNA.
ACCESSION   XR_004927981
VERSION     XR_004927981.1
DBLINK      BioProject: PRJNA615222
KEYWORDS    RefSeq.
SOURCE      Fundulus heteroclitus (mummichog)
  ORGANISM  Fundulus heteroclitus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Ovalentaria; Atherinomorphae; Cyprinodontiformes;
            Fundulidae; Fundulus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_046384.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Fundulus heteroclitus Annotation
                                           Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..574
                     /organism="Fundulus heteroclitus"
                     /mol_type="transcribed RNA"
                     /isolate="FHET01"
                     /db_xref="taxon:8078"
                     /chromosome="24"
                     /sex="male"
                     /tissue_type="pool"
                     /dev_stage="adult"
     gene            1..574
                     /gene="LOC118557761"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 1 sample
                     with support for all annotated introns"
                     /db_xref="GeneID:118557761"
     ncRNA           1..574
                     /ncRNA_class="lncRNA"
                     /gene="LOC118557761"
                     /product="uncharacterized LOC118557761"
                     /db_xref="GeneID:118557761"
ORIGIN      

aggacaggagtgtttgacccttggtcgcaacgagttgggctgaattgttttcactttaattgccttctaaaatagaaggcaattaatttttttcttcacttcatcgcttgtgtgcctacaaggatatttttgccacggagacctttttactgaaaggttcgaagattttattacagttgacttctgctttgaccgtgacctctttagtattagatttcaggtcataatgacctggatttacactaaaagataccatgagattattctactgcaggcaacctgtccaaggtgtcccccaccactcaaccaatgaccgctggagatggacaccaggcactcccccaaccctacaacgataagcagatgattttacaccattacggtctgccagtgggagggtttccgtggaacaattcttctgaaaggaatccccggggacgcactcattcatatgatgtgtttcaacatagtgtttgagctgggaattgtcctgcgacgtgatgtactgcagtcataagagcagctgttgagacccctctatgggcgagtacatacagtttcttttttcttgtag

//