LOCUS       XR_004838898             461 bp    RNA     linear   INV 17-AUG-2020
DEFINITION  PREDICTED: Vespa mandarinia uncharacterized LOC118444165
            (LOC118444165), ncRNA.
ACCESSION   XR_004838898
VERSION     XR_004838898.1
DBLINK      BioProject: PRJNA656956
KEYWORDS    RefSeq.
SOURCE      Vespa mandarinia (Asian giant hornet)
  ORGANISM  Vespa mandarinia
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita;
            Aculeata; Vespoidea; Vespidae; Vespinae; Vespa.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_023395850.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Vespa mandarinia Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..461
                     /organism="Vespa mandarinia"
                     /mol_type="transcribed RNA"
                     /isolate="Nanaimo"
                     /isolation_source="Nanaimo on Vancouver Island"
                     /db_xref="taxon:7446"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="thorax"
                     /dev_stage="worker"
                     /country="Canada: Nanaimo, Vancouver Island, British
                     Columbia"
                     /lat_lon="49.152809 N 123.943125 W"
                     /collection_date="2019-09-18"
                     /collected_by="John Duff"
     gene            1..461
                     /gene="LOC118444165"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 2 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:118444165"
     ncRNA           1..461
                     /ncRNA_class="lncRNA"
                     /gene="LOC118444165"
                     /product="uncharacterized LOC118444165"
                     /db_xref="GeneID:118444165"
ORIGIN      

aacatcgaatgtaaacatctcaggatgtctttgctgcaagtatcaacgattatttaagattatcattgcaatcgcgcgcgaagcaatgatttaatcgaatattttcagtatcgctgaaataaaaatatcgcgaagtagaagcagtgtttgttcgttcgggtttcgcgatttaaacaataagtgtattttcatcgattgtgtgcaatgcaatcgttagagtcagtgtttgttcacgaaaagtgttttgcttttttaacagtcacatagactgtatttataaaagacagtagagtttcgcgaagtaaattcagtgaccgttcgtttaaaaatatttatcgcgtaatagaatcagtgcatcattgaagaggatctcaatcaacttcgatgttgacctacttaattttaaagaatcatccatcttcaatttcgacttcaactgtgaacgagtgttttggagccat

//