2024-05-18 16:03:31, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_004632676 472 bp RNA linear VRT 23-MAY-2020 DEFINITION PREDICTED: Notolabrus celidotus uncharacterized LOC117820045 (LOC117820045), ncRNA. ACCESSION XR_004632676 VERSION XR_004632676.1 DBLINK BioProject: PRJNA634114 KEYWORDS RefSeq. SOURCE Notolabrus celidotus (New Zealand spotty) ORGANISM Notolabrus celidotus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Eupercaria; Labriformes; Labridae; Notolabrus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_048281.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Notolabrus celidotus Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..472 /organism="Notolabrus celidotus" /mol_type="transcribed RNA" /isolate="fNotCel1" /db_xref="taxon:1203425" /chromosome="10" /sex="male" /tissue_type="liver" /dev_stage="adult" /country="New Zealand: Tauranga" /lat_lon="37.39219 S 176.09222 E" /collection_date="24-May-2018" /collected_by="Simon Muncaster, Erica Todd, Neil Gemmell" gene 1..472 /gene="LOC117820045" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 3 samples with support for all annotated introns" /db_xref="GeneID:117820045" ncRNA 1..472 /ncRNA_class="lncRNA" /gene="LOC117820045" /product="uncharacterized LOC117820045" /db_xref="GeneID:117820045" ORIGIN
ccgtgcgacaggtgtctgtgctcgccctgaggatcctctctgtcgttttcatccatgaggcgtggagaaaaacgtaaggggtggagagagagacggagagacagagagagagactggaggtataaaaggtgtatacctgtcacaaacggcacacacgttcagtgcgcgtaaaaggatacctgaagacacaggagccagctgttacgcgcccattgtctgtctctcactcggatcatcattactttttgttgcgcctttttcatgtctgtatttgcttcacgttgagcctcacgcacaatacctgaagatgaagttttgttcgttcggctcgcgttatgcaggtacgggttggcaactggaaaagacgcaaactttgttttttcgttatgggggcatccccgctgcatcactgttgttgacaatgtcaatccgcagttaagactctgactgaagtaaagttgttttaaatttg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]