2024-04-20 06:10:03, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_004613194 244 bp RNA linear VRT 20-MAY-2020 DEFINITION PREDICTED: Hippoglossus hippoglossus uncharacterized LOC117757739 (LOC117757739), ncRNA. ACCESSION XR_004613194 VERSION XR_004613194.1 DBLINK BioProject: PRJNA627709 KEYWORDS RefSeq. SOURCE Hippoglossus hippoglossus (Atlantic halibut) ORGANISM Hippoglossus hippoglossus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Carangaria; Pleuronectiformes; Pleuronectoidei; Pleuronectidae; Hippoglossus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_047173.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Hippoglossus hippoglossus Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..244 /organism="Hippoglossus hippoglossus" /mol_type="transcribed RNA" /isolate="fHipHip1" /db_xref="taxon:8267" /chromosome="23" /sex="male" /tissue_type="muscle" /dev_stage="adult" /country="Canada: Atlantic Ocean" /lat_lon="44.63694 N 63.59167 W" /collected_by="Tony Einfeldt" gene 1..244 /gene="LOC117757739" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 6 samples with support for all annotated introns" /db_xref="GeneID:117757739" ncRNA 1..244 /ncRNA_class="lncRNA" /gene="LOC117757739" /product="uncharacterized LOC117757739" /db_xref="GeneID:117757739" ORIGIN
gccaaaggtcaaaggtcacggtgacctcacagaacaaaaaatgagaaactgtcacagggaccccatataaatctggaaaaaaatacgcacacagtgcagtgtttctagttattgttattgtctgatccttttatataagaatggtaaagtctactgtcataatgtggtgttggttttaattcaagtattttatcaagtgtttcaatcattgaaatattgacataataaactgcatatatacaga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]