2024-04-26 22:15:31, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_004473226 784 bp RNA linear INV 14-APR-2020 DEFINITION PREDICTED: Drosophila miranda uncharacterized LOC117189170 (LOC117189170), ncRNA. ACCESSION XR_004473226 VERSION XR_004473226.1 DBLINK BioProject: PRJNA623594 KEYWORDS RefSeq. SOURCE Drosophila miranda ORGANISM Drosophila miranda Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Diptera; Brachycera; Muscomorpha; Ephydroidea; Drosophilidae; Drosophila; Sophophora. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_046673.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Drosophila miranda Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..784 /organism="Drosophila miranda" /mol_type="transcribed RNA" /strain="MSH22" /db_xref="taxon:7229" /chromosome="XL" /sex="male" /tissue_type="Whole body" gene 1..784 /gene="LOC117189170" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 36 samples with support for all annotated introns" /db_xref="GeneID:117189170" ncRNA 1..784 /ncRNA_class="lncRNA" /gene="LOC117189170" /product="uncharacterized LOC117189170" /db_xref="GeneID:117189170" ORIGIN
tatgtacatacatacatatatttctttatgaaccaagagagcgctcatcagtgcaaaaagaaaaatatcttatgcataaagccacttacatacatatgtatgtatatacatacatacatacaccaacaacacacccagaacaaacacaaagaaataggctcaaaaacatacacatacacccatacatacaaatacatatatgtatgtacatatgtatataaaagcgaacccgaagcaaaggcacaaagcaaaatcgccaaaagcgaacatatgtatgtgcacacttatgaaaacccaattttctttttacgcttcgatttctgtatacgaatcgatgatacccaaaaacgaagggccaaaacgagacgcaatgacaaatggttggtggataagcgatggcggaattagcggtgtgtgaaaagggagaggagagccgggtacaaaggaagtatagaaagcgaaaaatacgatatatattacgttagagatgaccaggatcccaggaggcttaatttttcgaaaaagaatttccgagttcacgcccaactctgattgcccgctcaattaaagagcggaatgaacgagagccctgttaaaaatatgtttgattcgattgtctctgactggcaaacttcaattgttctagtatactcgtacactgctcttggtcacttgaatatatgcacttaaactaattatttttttgaagaaaaagtaacttatattaaaatttaatttgtagatattgtaaatcttagatttattagaaaaagaaaaaaaatga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]