2024-04-29 16:46:38, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_004216167 586 bp RNA linear PLN 17-DEC-2019 DEFINITION PREDICTED: Cucumis sativus uncharacterized LOC116403387 (LOC116403387), ncRNA. ACCESSION XR_004216167 VERSION XR_004216167.1 DBLINK BioProject: PRJNA182750 KEYWORDS RefSeq. SOURCE Cucumis sativus (cucumber) ORGANISM Cucumis sativus Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; fabids; Cucurbitales; Cucurbitaceae; Benincaseae; Cucumis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_026655.2) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Cucumis sativus Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.3 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..586 /organism="Cucumis sativus" /mol_type="transcribed RNA" /cultivar="9930" /db_xref="taxon:3659" /chromosome="1" /tissue_type="leaf" gene 1..586 /gene="LOC116403387" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 15 samples with support for all annotated introns" /db_xref="GeneID:116403387" ncRNA 1..586 /ncRNA_class="lncRNA" /gene="LOC116403387" /product="uncharacterized LOC116403387" /db_xref="GeneID:116403387" ORIGIN
gatttgataataaaatccgatgattctcttctactccttttcctatcccaagaaggaaagagacttataaatatgtggaagaaaacagttttatttaacaaattcattaagaaaaaaaccaaggcttttgctctacaaaagaaaagagtttctctcaactatctcaaaactttttttcatcccaattggtttctacaaaccaatctcatccgagaggatatgaaggtcttctgacgagtagtgtcccaattcggtggtttacagattcagcgacatcaactaaaggttgaaagacattattagaagaaaaacattgtcggttagcttcatgccacatcttgggtcgagtgaggtgatgctccaaaatgggttgtgacaataagaggggtaaaggaaagctagcgaatgacaagaagagattgtggttcaccatagggaataatagatgttttattccgcatttattgttttgagtattcaattttcagataattattttagaactcaagtttacttttaagatatttattttcactttaaacaaggtccaaactagtattttacctaatattttattattatttta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]