GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-01-25 21:23:47, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       XR_004216167             586 bp    RNA     linear   PLN 17-DEC-2019
DEFINITION  PREDICTED: Cucumis sativus uncharacterized LOC116403387
            (LOC116403387), ncRNA.
ACCESSION   XR_004216167
VERSION     XR_004216167.1
DBLINK      BioProject: PRJNA182750
KEYWORDS    RefSeq.
SOURCE      Cucumis sativus (cucumber)
  ORGANISM  Cucumis sativus
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; fabids; Cucurbitales; Cucurbitaceae;
            Benincaseae; Cucumis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_026655.2) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Cucumis sativus Annotation Release
                                           102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..586
                     /organism="Cucumis sativus"
                     /mol_type="transcribed RNA"
                     /cultivar="9930"
                     /db_xref="taxon:3659"
                     /chromosome="1"
                     /tissue_type="leaf"
     gene            1..586
                     /gene="LOC116403387"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 15 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:116403387"
     ncRNA           1..586
                     /ncRNA_class="lncRNA"
                     /gene="LOC116403387"
                     /product="uncharacterized LOC116403387"
                     /db_xref="GeneID:116403387"
ORIGIN      
gatttgataataaaatccgatgattctcttctactccttttcctatcccaagaaggaaagagacttataaatatgtggaagaaaacagttttatttaacaaattcattaagaaaaaaaccaaggcttttgctctacaaaagaaaagagtttctctcaactatctcaaaactttttttcatcccaattggtttctacaaaccaatctcatccgagaggatatgaaggtcttctgacgagtagtgtcccaattcggtggtttacagattcagcgacatcaactaaaggttgaaagacattattagaagaaaaacattgtcggttagcttcatgccacatcttgggtcgagtgaggtgatgctccaaaatgggttgtgacaataagaggggtaaaggaaagctagcgaatgacaagaagagattgtggttcaccatagggaataatagatgttttattccgcatttattgttttgagtattcaattttcagataattattttagaactcaagtttacttttaagatatttattttcactttaaacaaggtccaaactagtattttacctaatattttattattatttta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]