LOCUS       XR_004067606             277 bp    RNA     linear   PRI 30-SEP-2019
DEFINITION  PREDICTED: Gorilla gorilla gorilla uncharacterized LOC115931024
            (LOC115931024), ncRNA.
ACCESSION   XR_004067606
VERSION     XR_004067606.1
DBLINK      BioProject: PRJNA564096
KEYWORDS    RefSeq.
SOURCE      Gorilla gorilla gorilla (western lowland gorilla)
  ORGANISM  Gorilla gorilla gorilla
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Gorilla.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044618.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Gorilla gorilla Annotation Release
                                           102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..277
                     /organism="Gorilla gorilla gorilla"
                     /mol_type="transcribed RNA"
                     /isolate="Kamilah (stud number 0661)"
                     /sub_species="gorilla"
                     /db_xref="taxon:9595"
                     /chromosome="16"
                     /sex="female"
                     /cell_type="fibroblast"
                     /tissue_type="primary cell cultured fibroblast cell line"
                     /dev_stage="adult"
                     /breed="western lowland gorilla"
     gene            1..277
                     /gene="LOC115931024"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 1 sample
                     with support for all annotated introns"
                     /db_xref="GeneID:115931024"
     ncRNA           1..277
                     /ncRNA_class="lncRNA"
                     /gene="LOC115931024"
                     /product="uncharacterized LOC115931024"
                     /db_xref="GeneID:115931024"
ORIGIN      

ggcagctgttggagagggatgggtcaagggatggagggtagcactgtgagctgaaataggaggcaagaagagattgaagggaaatctcaaggggctccagagactactacaatggtgcaaagtcacagaagccctgggaaaagcaggtagaatggagttgccatgacactgagcctcatctagatgccagttccagatattggcagactgctggcctcctgaggagcacaggaaggggcctggcagactggtgatcctggttggacatgaagagggg

//