2021-01-24 06:31:15, GGRNA.v2 : RefSeq release 203 (Nov, 2020)
LOCUS XR_004067606 277 bp RNA linear PRI 30-SEP-2019 DEFINITION PREDICTED: Gorilla gorilla gorilla uncharacterized LOC115931024 (LOC115931024), ncRNA. ACCESSION XR_004067606 VERSION XR_004067606.1 DBLINK BioProject: PRJNA564096 KEYWORDS RefSeq. SOURCE Gorilla gorilla gorilla (western lowland gorilla) ORGANISM Gorilla gorilla gorilla Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Gorilla. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_044618.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Gorilla gorilla Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..277 /organism="Gorilla gorilla gorilla" /mol_type="transcribed RNA" /isolate="Kamilah (stud number 0661)" /sub_species="gorilla" /db_xref="taxon:9595" /chromosome="16" /sex="female" /cell_type="fibroblast" /tissue_type="primary cell cultured fibroblast cell line" /dev_stage="adult" /breed="western lowland gorilla" gene 1..277 /gene="LOC115931024" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:115931024" ncRNA 1..277 /ncRNA_class="lncRNA" /gene="LOC115931024" /product="uncharacterized LOC115931024" /db_xref="GeneID:115931024" ORIGIN
ggcagctgttggagagggatgggtcaagggatggagggtagcactgtgagctgaaataggaggcaagaagagattgaagggaaatctcaaggggctccagagactactacaatggtgcaaagtcacagaagccctgggaaaagcaggtagaatggagttgccatgacactgagcctcatctagatgccagttccagatattggcagactgctggcctcctgaggagcacaggaaggggcctggcagactggtgatcctggttggacatgaagagggg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]