LOCUS       XR_003863397             773 bp    RNA     linear   VRT 01-JUL-2019
DEFINITION  PREDICTED: Oncorhynchus nerka uncharacterized LOC115127581
            (LOC115127581), ncRNA.
ACCESSION   XR_003863397
VERSION     XR_003863397.1
DBLINK      BioProject: PRJNA548514
KEYWORDS    RefSeq.
SOURCE      Oncorhynchus nerka (sockeye salmon)
  ORGANISM  Oncorhynchus nerka
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Protacanthopterygii;
            Salmoniformes; Salmonidae; Salmoninae; Oncorhynchus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_021816460.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Oncorhynchus nerka Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..773
                     /organism="Oncorhynchus nerka"
                     /mol_type="transcribed RNA"
                     /isolate="On170113-E2"
                     /db_xref="taxon:8023"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="Caudal fin"
                     /dev_stage="fry"
                     /country="Canada: Pitt Lake, BC"
                     /genotype="Doubled Haploid"
     gene            1..773
                     /gene="LOC115127581"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 43 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:115127581"
     ncRNA           1..773
                     /ncRNA_class="lncRNA"
                     /gene="LOC115127581"
                     /product="uncharacterized LOC115127581"
                     /db_xref="GeneID:115127581"
ORIGIN      

tctctgtcagggtgtttgttccagagttcgtgtcgtctctctcggtgtctgtgagtggctgtacctggggggagggacttgtgaacggagactgttcattgtccctcacgctgggctcctcctccccccagggggagcttgtgagggtgaactgttctctgattggctgctcggccgttctcctcgctcccccatggaatacttggatacgagtcaccgtggatagttaccatagcaaccgaaccacagccttcagcatctcagtcaactacacagtgggttgtaagcctcagagcgtgggtatgtctggagacgattacattaacaggctccatggcaacagcggcacgacaacatcaccaggcaacggttctgtggtcgccgaggcaggtcgtcataacaacgtgtcgtcggagtgtgtgtggagtgtcccggtgctccgtgaggaactagacgttctgtctgtccggttcactcccattaacggacctaatgtaacggtcacacacacacaccccacgctcctcacctaccccctcaacacacagtctactggagggaccttgaacctggagattacactcaacactgtgagtaacacacacacaccccacgctcctcacctaccccctcaacacacagtctactggagggaccttgaacctggagattacactcaacactactaatacaacgttaggaaacagcagtgtgatggcctgtctctcttcctgggctcctgtcctcgcactcaactactcccatccctgtca

//