LOCUS       XR_003831960             502 bp    RNA     linear   VRT 06-JUN-2019
DEFINITION  PREDICTED: Cottoperca gobio uncharacterized LOC115005526
            (LOC115005526), ncRNA.
ACCESSION   XR_003831960
VERSION     XR_003831960.1
DBLINK      BioProject: PRJNA530544
KEYWORDS    RefSeq.
SOURCE      Cottoperca gobio
  ORGANISM  Cottoperca gobio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Eupercaria; Perciformes; Notothenioidei;
            Bovichtidae; Cottoperca.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_021166923.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Cottoperca gobio Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..502
                     /organism="Cottoperca gobio"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:56716"
                     /chromosome="Unknown"
     gene            1..502
                     /gene="LOC115005526"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 1 sample
                     with support for all annotated introns"
                     /db_xref="GeneID:115005526"
     ncRNA           1..502
                     /ncRNA_class="lncRNA"
                     /gene="LOC115005526"
                     /product="uncharacterized LOC115005526"
                     /db_xref="GeneID:115005526"
ORIGIN      

gttccggtgactacaaatgccaagccagctcaacagtcggggctgctggtgttgtcagccgcatgcctcgtacatgtgtgtgtggatactagagtatcgtatcttctcgttgacggcgtcctccgcctccctggccacgcccccgtccttgacctctaacgccagccgggccgtcgcagcctgcagacgcttcctgagcgcctgtgggaggtaaatctccacctgctgcagctggttcctggcggccttcatgttcctcgtcttgtcgtttctcttcaggtagttgaacctcaggttgctgaaacgcttcttcagctccttaaaggagtcgcggagctggaaaattaaacatcggaaaaatcagtgatgttgacagaaacgtgttttgtgaggtcacattgacctttgacccccaaaatctaattctttcctttttttttacatgttgttgttgagattaagcatcaaactattttattatgagtttctattattgtttgca

//